From the following DNA strand: AAGCTAGGATTGCC How many codons would be present?

The following DNA sequence corresponds to the two extreme ends of a gene's coding region: 10 5' ATG-GAA-CCG Each codon is separated by a dash and the middle of the gene is represented by "...". Refer to the codon table to answer each question. First position (5' end) U 13 C #t A U UUU UUC UUA UUG CUU CUC CUA CUG Phe Leu Leu AUU AUC lle AUA CAG-TGA 3' * $ UCU UCC UCA UCG CCU CCC CCA CCG ully understand the concept covered in this question? ACU ACC ACA 15 Second position C A U ( 49 Ser U Pro Thr 16 UAU UAC UAA stop UAG stop 4- CAU CAC CAA CAG AAU AAC AAA It's Muddy Tyr 17 His Gln Asn Glu Q Search S It's Clear J+ & UGU U UGC C UGA stop A UGG Trp G CGU CGC CGA CGG AGU AGC AGA G LC 18 N Cys Arg Ser * fg U C A G hp U C A a DII Third position (3' end) ✓ Submit Answer C f10 ( O □

In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand?

According to wobble rules, what codons should be recognized by the follow- ing anticodons? What amino acid residues do these correspond to? (а) 5' —1CC—3' (b) 5'-GCU-3'

b) For a DNA strand with the given genetic code of bases , undergoing transcription, what will be the complimentary RNA strand? Provide the direction as well as 5" and 3" indicators for the new genetic genome. 5" G-A-A-C-T-G-G-A^T-T-C-T-A-C-C3'.

Write the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA TGTGCGCGCGGGGCG

The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution mutations (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons.(a) How many total mutations are possible?(b) How many of these mutations are “silent,” in the sense that the mutantcodon is changed to another Arg codon?(c) How many of these mutations are conservative, in the sense that an Argcodon is changed to a functionally similar Lys codon?

A template DNA strand coded for the following sequence: CTCAAGTTATGTATGTCCGATTCGCATGCGCT 1) What is the sequence of the complementary mRNA strand? 3 po 2) What is the sequence of the coding DNA strand? 3) After translation was complete, the resulting polypeptide underwent post-translational modification wherein the N-terminal Met residue was removed from the polypeptide. Using one-letter abbreviations, write out the resulting amino acid sequence of the polypeptide after post-translational modification.

The DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter Gly

What is the DNA (template) strand of the following DNA (coding) strand: CAGGATGAATTGCTC