From the following DNA strand: AAGCTAGGATTGCC How many codons would be present?

The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution mutations (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons.(a) How many total mutations are possible?(b) How many of these mutations are “silent,” in the sense that the mutantcodon is changed to another Arg codon?(c) How many of these mutations are conservative, in the sense that an Argcodon is changed to a functionally similar Lys codon?

What is the DNA (template) strand of the following DNA (coding) strand: CAGGATGAATTGCTC

Using the genetic code, interpret the following set of nucleotides. AUGGGUCCAUGGCGUAGGCCAAAUGAUGAGGAAUGA

Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code table

The sequence of a polypeptide is determined by the order of codons that specify the amino acids in the polypeptide. How many different sequences of codons can specify the polypeptide sequence methionine-histidine-lysine? (Use the table to find the number of possibilities.) SECOND BASE UAU UACFTyrosine (Tyr) UAA -Stop codon UAG -Stop codon UUUL UGU Cysteine (Cys) UCU uc UCA FSerine (Ser) uca Uuc Phenylalanine (Phe) UUAL Leucine (Leu) CAU CAC CAA Glutamine (Gin) CAGF UGA -Stop codon uaa -Tryptophan (Trp) CGU сос CGA FArginine (Arg) CU CU Histidine (His) CuA FLeucine (Leu) Cua) Proline (Pro) CCA cca AAU Asparagine (Asn) AGU Serine (Ser) AGC AUU ACU ACC Threonine (Thr) AACF AAA AAGLysine (Lys) AUC Fisoleucine (lle) AUA Methionine (Met) AUG - Start codon ACA ACG AGA AGGFArginine (Arg) GU GACAspartic acid (Asp) GGA GAA Glutamic acid (Glu) Gaa) GcU -Valine (Val) G GUA GCA FAlanine (Ala) Glycine (Gly) 8. 1 4 THIRD BASE 2. FIRST BASE

Give the coordinate for the last base of the first exon for tra-RB; type a number as in 7,000 (include the comma)

Insulin is synthesized as preproinsulin, which has 81 amino acids. How many heterocyclic bases must be present in the informational DNA strand to code for preproinsulin (assuming no introns are present)?

A nontemplate strand of bacterial DNA has the following base sequence. What amino acid sequence will be encoded by this sequence? 5′ –ATGATACTAAGGCCC–3′

look at the code: import random # Define the DNA nucleotidesnucleotides = ["A", "T", "G", "C"] # Define the codon-to-amino acid dictionarycodon_table = {    "AUG": "M",   # Start codon    "UUU": "F",    "UUC": "F",    "UUA": "L",    "UUG": "L",    "UCU": "S",    "UCC": "S",    "UCA": "S",    "UCG": "S",    "UAU": "Y",    "UAC": "Y",    "UAA": "*",   # Stop codon    "UAG": "*",   # Stop codon    "UGU": "C",    "UGC": "C",    "UGA": "*",   # Stop codon    "UGG": "W",    "CUU": "L",    "CUC": "L",    "CUA": "L",    "CUG": "L",    "CCU": "P",    "CCC": "P",    "CCA": "P",    "CCG": "P",    "CAU": "H",    "CAC": "H",    "CAA": "Q",    "CAG": "Q",    "CGU": "R",    "CGC": "R",    "CGA": "R",    "CGG": "R",    "AUU": "I",    "AUC": "I",    "AUA": "I",    "AUC": "I",    "ACU": "T",    "ACC": "T",    "ACA": "T",    "ACG": "T",    "AAU": "N",    "AAC": "N",    "AAA": "K",    "AAG": "K",    "AGU": "S",    "AGC": "S",    "AGA": "R",    "AGG": "R",    "GUU": "V",    "GUC": "V",    "GUA": "V",…