Geraniol OH Squalene Farnesol OH 10. Isoprene units are the building block of isoprenoid. Circle the five-carbon isoprene units in each compound,

Q: QUESTION 2 10 11 12 Glucose Pyruvic acid 2 ATP Lactic acid 13 36 ADP 36P 36 ATP Match the FOLLOWING:…

A: Answered the question.

Q: 4. The interaction of Vitamin D3 with lipid membranes may be studied using different techniques. One…

A: A class of fat-soluble secosteroids is called vitamin D3 .Vitamin D3 is a kind of vitamin D that is…

Q: What is the driving force that promotes secondary structure formation of alpha helices and beta…

A: Alpha-helix and beta-sheets are the two most prominent regular secondary structures in protein.…

Q: 13. What value do N-linked saccharides serve for membrane surface proteins? Which amino acid…

A: N-linked saccharides, also known as N-linked glycans, play several crucial roles in the function of…

Q: Provide a stepwise, arrow-pushing mechanism for the following transformation. You may use general…

A: The reaction in question involves a lysis reaction catalyzed by a lyase enzyme using the coenzyme…

Q: Identify the product of the given reaction. IV I II III heat ? = III IV

A: Option (d) III is correct See solution in image  Explanation:

Q: In N-linked glycoproteins, the sugar molecule is usually bound to a Asp b Ser c Asn d Thr

A: Glycoproteins are conjugated biomolecules where a protein is covalently bound to a carbohydrate…

Q: PLease help me fill in all the information

A: 1. Pyruvate to Alanine:Pyruvate is a three-carbon compound produced during glycolysis, which is the…

Q: None

A:

Q: Camels survive in the desert because they derive water from the large deposit of triglycerides…

A: We are considering the breakdown of the triglyceride, tripalmitoylglycerol. Tripalmitoylglycerol is…

Q: Give me a question I can ask my professor about regarding this

A: If you have any questions, please let me know. I am grateful to help you :)

Q: With the advent of photosynthesis, the amount of oxygen in the atmosphere has varied over the eons…

A: Approach to solving the question:Detailed explanation:Examples:ANSWER IS 12 ML H20  Key references:…

Q: The enzyme ẞ-methylaspartase catalyzes the deamination of ẞ-methylaspartate: CH, NH, OOC-CH-CH-COO…

A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…

Q: STEM Workplace Practices Q5

A: The statement is false. Analytical methods are not assessed only once in their lifecycle for…

Q: B- Calculate the missing value of the amino acids listed in the table below. Amino acid…

A: Amino acids are the basic units of proteins. They have an amino group, a carboxyl group and a side…

Q: (Biochemsitry, Topics: Glycolysis and Citric Acid Cycle)  - How many ATP are formed from the…

A: The complete oxidation of fructose in the liver involves a series of biochemical reactions that…

Q: Which model (2D topology or trRosetta) is likely a better representation of the actual protein AlaE,…

A: In the context of protein structure prediction, the posterior probability is generally considered a…

Q: 0.25 Short answer questions, write answers on blank paper. A plot of enzyme activity with and…

A: LB plot is a double  reciprocal plot which is constructed by taking inverse values of substrate…

Q: ALL POSSIBILE PRODUCTS

A: Crossed  aldol condensation is a type of aldol condensation reaction where two different carbonyl…

Q: please explain the question, i am unable to input values of x

A: The dependent variable, the reaction rate (µmol/L/min), is usually plotted on the y-axis and is…

Q: (b) The hemoglobin subunits expressed in a growing fetus and adult mother are different from each…

A: Hemoglobin is a globular protein, ie it is roughly spherical. It is a tetramer of two types of…

Q: DRAW ON PAPER PLEASE - Amylose is a linear polymer of several thousand glucose units linked by (14)…

A: Amylose is a polysaccharide. It is made up of -D-glucose residues linked via (14) glycosidic linkage…

Q: You have a racemic mixture of d-2-butanol and l-2-butanol. The d isomer rotates polarized light by…

A: The objective of this question is to determine the rotation of the polarization of light of a…

Q: An π helix can be described as a 4.4 helix. Explain 16 what this designation means. Given the pitch…

A: ●A π helix is a type of secondary structure found in proteins.The amino acids in a standard π-helix…

Q: Histone modifications are inherited across ________ but not ________.   Question 6 options:…

A: Histone modifications are inherited across mitosis but not meiosis.  Histone modifications are…

Q: Draw the products of the reaction of xylulose-5-phosphate and erythrose-4-phosphate catalyzed by…

A: The Pentose Phosphate Pathway also known as the Hexose monophosphate shunt is a metabolic pathway…

Q: Carbamazepine is a lipid -soluble antiepileptic drug that has a larger volume of distribution in…

A: The objective of the question is to understand the impact of obesity on the elimination half-life of…

Q: Estimate the total osmolarity of a 2-in-1 TPN bag containing D14W AA 6% plus 160 mEq KCl and 140 mEq…

A: Osmolarity is the number of solute particles per litre of the solution. First we determine the…

Q: Draw the structure of phosphatidylcholine at pH 7 with the moiety on R₁ as 14:0 (C14) and R2 as…

A: Major elements of biological membranes are phospholipids, which include phosphatidylcholine and its…

Q: BIOMOLECULES - Please answer the questions properly. - Multiple choice 1. Which of the following…

A: OPTION A : It outlines an enzymatic two-step mechanism that converts AMP to ADP and subsequently ADP…

Q: Question 7

A: The objective of this question is to determine how many of the bacterial cells will be radioactive…

Q: What property makes phosphatidylcholine a good emulsifying agent whereas triglycerides are not?…

A: Phosphatidylcholine contain hydrophilic head group and hydrophobic tail group.

Q: (b)( ) In mature erythrocytes (red blood cells) the end product of glycolysis is lactate because of…

A: The table shows the rate of lactate production in hemolysates (lysed red blood cells) of human…

Q: If someone's pH increases above 7.8, they die. How much would the % buffer have to shift from normal…

A: The usual pH range for blood is 7.35 to 7.45. The body's buffering systems, such as the phosphate…

Q: Draw a pathway diagram showing the involvement of Rubisco in the Calvin cycle andphotorespiration…

A: To address the question effectively, I'll provide a detailed response for each part: Pathway…

Q: raw the reaction between sphingosine and arachidonic acid. Draw out the full structures.

A: Sphigosine is the platform molecule of sphingolipids. Arachidonic acid is a 20 carbon fatty acid…

Q: Construct the two enantiomeric forms/structure of the following monosaccharides and designate the…

A: Monosaccharides are simple sugars, the basic units of carbohydrates. There are two types of…

Q: 11. A polypeptide is making a short a-helix. A typical residue in an a-helix is involved in two…

A: In an alpha helix, each amino acid residue forms hydrogen bonds with the amino acid located three…

Q: Derive an Equation that explains the realtionship between kE and kN with respect to the equilibrium…

A: Equation: This reaction is governed by the equilibrium constant ​, where:       - (1)Assuming that…

Q: _________ could lead to an epigenetic disorder caused by loss of function of a gene.   Question 12…

A: Epigenetics is the study of how the behavior and environment can cause changes that affect the way…

Q: What is(are) the only active site(s) not used in the second round of fatty acid synthase? Select all…

A: Here's a breakdown of why these are not used in the second round: Acetyl-CoA ACP Transacylase: This…

Q: 5'-AATGCCTCAGCCGATCTGCCTCGAGTCAATCGA TGCTGGTAACTTGGGGTATAAAGCTTACCCATGGTATCGTAG…

A: PCR is a lab technique used for amplification of target DNA sequence by using a thermostable DNA…

Q: Propose structures for intermediates A and B in the scheme below. This three-step conversion is…

A: Citrate is isomerized to isocitrate in the citric acid cycle via dehydration and rehydration. These…

Q: The peptide below H3N-CH- I NH–CH -NH-CH -NH-CH CH3 CH2 CH2 CH2 CH2 H₂C-CH HỌCH, NH–CH CH2 OH -OH…

A: Peptides are composed of amino acids. Ionizable groups in a peptide are the N-terminal alpha-amino…

Q: 1. Draw the Fisher projection of D-glucose, and from Fisher to Haworth projection of ẞ-D-glucose.…

A: The configurations of the D-glucose are: R , S , R , RIn β−D−glucose C1 -OH is present on the up…

Q: 45. A 5-year-old girl with a history of recurrent infections since the age of 4 months is brought to…

A: The objective of the question is to identify the immune system component that is most likely…

Q: Identify which one among the 6 carbohydrates; Glucose, fructose, maltose, lactose, sucrose or starch…

A: CarbohydratesMolisch TestBenedict's TestSeliwanoff's testlodine testBial's testMucic acid…

Q: Please help me fill out this worksheet

A:

Q: a) Based on the data shown in the image, what are the Km and Vmax for the enzyme with  L-DOPA and…

A: Enzymes catalyse biochemical reactions by lowering their activation energy. Enzymes bind to their…

Q: Genetics Q3

A: The question is asking us to determine the percentage of Adenine (A), Guanine (G), and Cytosine (C)…