Fruit flies infected by fungi are protected by drosomycin and when infected by bacteria are protected by---- A defesin b e pluribus c paromomysin d puromycin e offensin
Q: ELISA requires the use of blocking solution; what is the purpose of the solution?
A: The enzyme-linked immunosorbent assay captures target antigens (or antibodies) in samples using a…
Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…
A: Mutations are sudden heritable changes in the nucleotide sequence of a gene that changes the amino…
Q: C3 pathway happens in this process. O Light Reaction O Calvin Cycle O Both Light Reaction and Calvin…
A: Introduction Photosynthesis is separated into two phases: photochemical and biosynthetic…
Q: laborate the advantage and disadvantages of Nano-Plant Growth Regulator
A: Plant growth regulators are the substances that support the growth of plants and are being applied…
Q: Using a spider diagram or map, show the techniques, application and importance of recombinant DNA…
A: Introduction :- Recombinant DNA technology involves the development of Recombinant DNA (rDNA)…
Q: when a product built by the cell induces additional gene expression you have
A: Protein is the ultimate product of the gene expression process. It is a complex process involving…
Q: You are supplied with the following information about a DNA molecule: The molecular weight of a…
A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…
Q: Metabolic syndrome is a clustering of various conditions including high blood pressure, high blood…
A: Answer :- Option (C) is correct. - Insulin receptor phosphorylation increases insulin secretion.
Q: Answer the two parts of the question. a) Explain what gene therapy involves. b) Discuss how gene…
A: Gene therapy presents one of the best technical difficulties in current medicine. It is…
Q: What volume of 10X TBE buffer should you use to make 100mL of 1X TBE buffer? 10mL 1mL 0.1mL 100mL
A: TBE buffer stands for Tris-Borate-EDTA buffer. It is used for both agarose and polyacrylamide gel…
Q: are bacterial cells eukaryatic or prokaryotic?
A: Cell is a microscopic structure exhibited inside the living organisms . It can be one in number or…
Q: Nutrients in the soil, such as phosphorus and potassium, play an important role in plant…
A: “Nutrients are the compounds required and that provide energy, allowing to heal and in the…
Q: Some types of hormones regulate appetite. Which the hormones trigger the feeling of hunger and which…
A: The hormone which majorly triggers the feeling of hunger is Ghrelin. It is also known as the “hunger…
Q: design a bacterial/archaeal species, what would be its characteristics (e.g. shape, arrangement,…
A: Bacteria are small unicellular microorganism that lacks any proper cell organization (which means no…
Q: A classical experiment studying the fate determination of stem cells in the developing embryo uses…
A: Neural crest cells give rise to melanocytes, smooth muscles cranial cartilage, facial cartilage and…
Q: If you cloned GFP under the control of the V. fischeri Lux promoter, when would you see GFP…
A: Vibrio fischeri exhibits bioluminescence only when the density of its cell is higher and…
Q: 9. Suppose you accidentally introduce a small plant-eating beetle into your self-contained…
A: You construct a self-contained ecosystem in a jar, following some instructions. Your ecosystem…
Q: Does sexual selection have the potential to accelerate speciation, please provide an example..
A: Sexual selection has a reputation as a major cause of speciation, one of the most potent forces…
Q: mystery compound, compound B. You add it to the dish with your hippocampal circuit. You fire the…
A: EPSP is excitatory post synaptic potential which is initiated by the movement of positively charge…
Q: Please help Why did we use biodegradable nanoparticles? Please use The worksheet below and don’t…
A: Biodegradable Nanoparticles (BNPs) are basically particles with matter of interest (such as gene…
Q: what two reactants are combined to form a molecule of ATP?
A: what two reactants are combined to form a molecule of ATP? Introduction: The essential molecule for…
Q: Enumerate primary organ rudiments that have started to take form in the 24 – hour chick embryo…
A: Introduction A multicellular organism's embryo is the first stage of development. Embryonic…
Q: Write down the levels of ecosystem organization from smallest to largest, next to its' description.…
A: We will answer the first question as the single question is not specified. Please specify the…
Q: 2. The largest population an ecosystem can support is the carrying capacity determine by the which…
A: Ans: 2 Carrying capacity, limiting factors Explanation: The largest population an ecosystem can…
Q: If an antisense RNA is designed to silence the following mRNA sequence, which of the following…
A: mRNA sequence:-5' UAGGACUAUUAAGGUACACCCAUU 3' to silence this sequence the antisense RNA should be…
Q: Which types of macromolecules (protein, carbohydrate, fat, or nucleic acid?) can be enzymatically…
A: In mouth digestion of Carbohydrates begins. With the help of salivary amylase enzyme, breakdown of…
Q: Which of the following is not true regarding DOGEMs sequencing? it could result in more than one…
A: Answer :- Option (A) is correct. - It could result in more than one complete phage genome sequence.
Q: principle of a plant virus that transmits through an animal vector
A: A virus is a small microscopic infectious microbe that is non-living until and unless it finds a…
Q: Protein secondary structure pricipally arises from A H-bonding of backbone atoms in peptide groups…
A:
Q: Lungfishes Amphibians Mammals Amnion Lizards and snakes Crocodiles Ostriches Feathers Hawks and…
A: According to Bartleby guidelines , we are supposed to answer first three subparts in case of…
Q: Question z Methanogens are always engaged in relationships with other microbes because methane…
A: Answer- interspecies hydrogen Transfer. Interspecies hydrogen transfer (IHT) is a form of…
Q: Describe the process of translation of DNA to RNA.
A: DNA is the genetic materials of us.
Q: Please help Why did we use nanoparticles?
A: Nanoparticles are the techniques which are used in the biotechnology which used to identify the gene…
Q: of most hemoglobins when: 1. deoxygenated blood enters the capillaries in the lungs. 2. oxygenated…
A: Answer :: Hemoglobin-oxygen dissociation curve as the name suggests describes the relation…
Q: Case one: A 45 years old male who is a participant in a new medicine trial that blocks the renal…
A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…
Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…
A: CGA codes for Arginine. GGA codes for Glycine. Since the protein being coded for is completely…
Q: How does temperature and PH affect the activity of enzymes.
A: Introduction Enzymes function as catalysts. Proteins are the most common, although some RNA…
Q: You are studying the process of oxidative phosphorylation in the lab. You isolate several…
A: Mitochondria is also known as the powerhouse of the cell.
Q: You are studying a pathogenic bacterium which secretes a toxin that affects G protein receptor…
A: The cAMP signaling pathway, commonly referred to as the adenylyl cyclase pathway, is a cell…
Q: Which is a common element of protein structure? A legume root nodule with symbiotic nitrogen -…
A: N glycosidic bond is formed to link glycoproteins to sugar or carbohydrate implicating serine,…
Q: GEL ELECTROPHORESIS What is the purpose of gel electrophoresis?…
A: DNA, RNA and proteins are macromolecules. There are different techniques to separate them.
Q: A classical experiment studying the fate determination of stem cells in the developing embryo uses…
A: Answer :- Option ( D) is correct. - The organs arising from quail somites develop in the reverse…
Q: populations of flightless grasshoppers (Population A and B) are separated by a river that contains…
A: This is a type of natural selection occurring here. Natural selection was a concept given first by…
Q: 22. It is a microbial infection of the bladder. 23. It is the infection of the renal pelvis. 24. It…
A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…
Q: Bradley did two test PCR experiments with his phage genomic DNA. For one experiment he used G…
A: For categorizing phages, the term 'clusters' is used for groups of similar phages. It aids in…
Q: Describe the process of Translation of mRNA to DNA.
A: Ribonucleic acid (RNA) can be described as a chemical present in a wide range of living creatures,…
Q: Did you have an experience when a stranger acted caring and was helping you? What impact did that…
A: Empathy creates a connection that enables us to feel compassion. We can sense the suffering of…
Q: Organisms with favorable characteristics are more likely to survive and pass on their traits to…
A: Variation means genetic differenced between cells, individual organisms or group of organisms.…
Q: David isolated 3 unidentified strains of bacteria from a patient's wound. He wants to determine if…
A: Lysogeny is the state where a host cell contains one or more prophages and lysogenic cells contains…
Q: What is the main reason for archiving your phage? so that you could repeat the DNA isolation (for…
A: The answer is to store your phage long term so that anyone who accesses the phage database could…
Fruit flies infected by
A defesin
b e pluribus
c paromomysin
d puromycin
e offensin
Step by step
Solved in 2 steps
- 3. The table on the last page compares for each of four different proteolytic enzymes the chemical bonding structure of a classical substrate with the structures of two competitive inhibitors. For each substrate structure an arrow indicates the position of the scissile bond, i.e., the bond that is cleaved through catalytic action. For each enzyme, one of the inhibitors is a classical competitive inhibitor while the other is a transition-state inhibitor analog. While ordinary competitive inhibitors are associated with (dissociation) inhibitor equilibrium con- stants of ~10-3 to 10-6 M, transition-state analogs exhibit inhibitor constants ≤ 10-⁹ M. (a) For each enzyme draw a circle around those parts of the substrate that account for specificity of substrate recognition. (b) For each enzyme identify the transition-state inhibitor analog by drawing a circle around it and give a brief explanation of why it mimics the structure of the transition-state species. (c) Draw a "generic"…What is the name of the fungal toxin that inhibits RNA polymerase Il at 1 microgram/mL concentration? O Flavopiridol a-Amanitin O Triptolide DRB (5,6-Dichloro-1-ß-D- ribofuranosylbenzimidazole)Is covid still deadly
- Bacillus anthracis (Anthrax) Shape and arrangement of your pathogen Bacillus shape and Streptobacilli arrangement Type of flagella, number and correctly named arrangement of the flagella (example: monotrichous) My pathogen is one of the few in its specie that is not motile. It contains one flagellin gene, however four essential proteins contain point mutations and frameshifts. Therefore, the flagella are nonfunctional and the organism lacks motility; Atrichous. Capsule or not (If yes, describe what is it made from) Yes. It is made of poli-y-D-glutamic acid (PGA). According to Frontiers in Immunology, “Bacillus anthracis poly-γ-D-glutamic acid (PGA) capsule is an essential virulent factor that helps the bacterial pathogen to escape host immunity.” Gram staining status OR acid-fast stain cell wall description. Explain why your pathogen has this status by describing your pathogen's cell wall structure. Gram positive-…Under cellular conditions, dATP can be oxidized to its 2-hydroxy form, which is a substrate for an enzyme that converts 2-OH-dATP to 2-OH-dAMP + PPi. Explain why compounds that inhibit the activity of this enzyme would be eff ective anticancer agents.2 3 inte tion of Lormhda. ne att si ucated betwee de ne att sites and go ns one te n vacter aged ot utilize doot ractose ato la t don s gal* uc Integration to form prophage om SOward cor coct some cro on! ni imple ex 2 3 bio* gal* 14. The figure provided portrays the integration of Lambda phage into a host chromosome at the att site, located between the gal+ and bio+ genes. This prophage may disintegrate from the host carrying with it host genes, such as gal+ and/or bio+ and go on to transduce another host bacterium. How would one determine if a gal- host bacterium's phenotype was changed from gal- to gal+? To clarify, the minus version cannot utilize galactose as a carbon source for growth because it does not produce galactase, the enzyme that hydrolyzes galactose into monomeric sugars. There is a straight forward answer/solution to this – do not concoct some crazy solution! Think simple experiment.
- why is there a myth saying covid 19 can be spread through mosquito bitesif our immume systems are capable of attacking the trypanosome, why do you think we might see the number of parsites in a untreated person's blood repeatedly rebound in that way?Adapting to Host Defenses Surface proteins called HLAs allow white blood cells to detect HIV particles and fight an infection. In a recent study, scientists tested whether HIV is adapting to this host defense. They did so by looking at the frequency of a specific mutation (1135X) in HIV. This escape mutation helps the virus avoid detection by a version of the HLA protein (HLA-B51) that is common in some regions of the world, but not in others. FIGURE 20.19 shows the percentage of HIV-positive people who had HIV with the 1135X mutation. Data were collected at medical centers from several parts of the world. FIGURE 20.19 Regional variation in the frequency of the 1135X escape mutation among HIV-positive people. For each region, pink bars represent the percentage of people whose blood cells have HLA-B51. and thus cannot detect 1135X mutants. Blue bars represent the percentage of people with other versions of the HLA protein. These people have blood cells that can detect and fight HIV even if it has the 1135X mutation. 1. What percentage of people with H LA-B51 in Vancouver had HIV with the escape mutation for this protein?