Figure 9.10 You isolate a cell strain in which the joining together ofOkazaki fragments is impaired and suspect that a mutation has occurredin an enzyme found at the replication fork. Which enzyme is most likelyto be mutated?-Origin of Replication-RNA primerTemplatesrandsLeadingDNASvand potymerseSandHelicaseONAgmeDNARNAOkazakimagmentpolymeraseFigure 9.10 A replication fork is formed by the opening of the origin of replication, and helicase separates theDNA strands. An RNA primer is synthesized, and is elongated by the DNA polymerase. On the leading strand,DNA is synthesized continuously, whereas on the lagging strand, DNA is synthesized in short stretches. The DNAfragments are joined by DNA ligase (not shown).

The process of creating a copy of DNA is referred to as DNA replication. In a eukaryotic cell, this…

Figure 9.10 You isolate a cell strain in which the joining together of Okazaki fragments is impaired and suspect that a mutation has occurred in an enzyme found at the replication fork. Which enzyme is most likely to be mutated? -Origin of Replication RNA pimer Tempae srands Leading DNA Ssrand polymecse Seand Helicase DNA polymera Okazaki agment ONA agase RNA Figure 9.10 A replication fork is formed by the opening of the origin of replication, and helicase separates the DNA strands. An RNA primer is synthesized, and is elongated by the DNA polymerase. On the leading strand, DNA is synthesized continuously, whereas on the lagging strand, DNA is synthesized in short stretches. The DNA fragments are joined by DNA ligase (not shown).

Figure 9.10 You isolate a cell strain in which the joining together of Okazaki fragments is impaired and suspect that a mutation has occurred in an enzyme found at the replication fork. Which enzyme is most likely to be mutated? -Origin of Replication RNA pimer Tempae srands Leading DNA Ssrand polymecse Seand Helicase DNA polymera Okazaki agment ONA agase RNA Figure 9.10 A replication fork is formed by the opening of the origin of replication, and helicase separates the DNA strands. An RNA primer is synthesized, and is elongated by the DNA polymerase. On the leading strand, DNA is synthesized continuously, whereas on the lagging strand, DNA is synthesized in short stretches. The DNA fragments are joined by DNA ligase (not shown).

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 2VCQ: Figure 14.14 You isolate a cell strain in which the joining of Okazaki fragments is impaired and...

See similar textbooks

Similar questions

Labeling DNA Replication Directions: Drag the lahels from the left tn corrary derti theinats of ar=rlicating strandarA 24 Newly Created Strand of ONA Replication Carke Original DNA Strand Replication Direction of Origin of Replication Directions: Bolow is a more in-depth look at a replication bubble. A.l of the psrts are still tne came, but
In eukaryotes the DNA replication rate is 50 nucleotides persecond. How long does the replication of a chromosome of150 million base pairs take? If eukaryotic chromosomeswere replicated like those of prokaryotes, the replication of agenome would take months. Actually, eukaryotic replicationtakes only several hours. How do eukaryotes achieve thishigh rate?
Assume that a certain bacterial chromosome has one origin of replication. Under some conditions of rapid celldivision, replication could start from the origin before thepreceding replication cycle is complete. How many replication forks would be present under these conditions?
Which of the following statements about DNA replication is INCORRECT? It is powered bythe hydrolysis of ATP. Each strand withinthe DNA double helix is used as a template for synthesis of a new strand. It requires that both strands of the double helix be separated from each other. It proceeds withthe addition of new nucleotides to the 3′ end of a growing DNA strand. It begins atmultiple origins of replication sites along eukaryotic chromosomes.
he bases of one of the strands of DNA in a regionwhere DNA replication begins are shown at the endof this problem. What is the sequence of the primerthat is synthesized complementary to the bases inbold? (Indicate the 5′ and 3′ ends of the sequence.)5′ AGGCCTCGAATTCGTATAGCTTTCAGAAA 3′
Polymerases usually add only about 10 nucleotides toa DNA strand before dissociating. However, during replication, DNA pol III can add tens of thousands ofnucleotides at a moving fork. How is this additionaccomplished?
This is the original strand of DNA: ATG AAG TTT GGC TAA - what would represent a frameshift mutation due to deletion during replication ?
A seiee hserved under a microscope, researchers observe that the DNA is able to be SE be replicated. Based on this observation, which protein involved in DNA replication is most likely mutated? To answer the question please: I) draw a scheme of DNA replication; 2) name the proteins that are required for DNA replication; 3) propose the consequences of the process.
Review Figures 8.12 and 8.13. In cells, the primers forDNA synthesis are short strands of RNA, so each newlysynthesized strand of DNA has a segment of RNA atits 5′ end. As replication proceeds, DNA polymerasesremove these RNA segments and fill in the resulting gapswith DNA. However, the gaps at the very 5′ ends of thenew strands cannot be filled in with DNA. Why not?DNA replication leaves exposed about 100 nucleotidesat the 5′ end of each template strand, and these singlestranded ends are removed. What are the effects of this“end problem” on a cell’s DNA as it continues to divide
Escherichia coli's chromosome has a replication origin called OriC. Draw a schematic diagram to show the specific DNA sequences that is essential for replication function scattering over a 245 base pair of Oric region.
Replication of a circular DNA molecule can occur by either theta () replication or by rolling circle replication. Describe or explain three differences between these two modes of DNA replication (you must accurately describe differences between the two approaches to replication - an accurate statement about one form of replication that does not clearly indicate how the other form differs is not a correct)
Indicate the proteins involved in the following steps of DNA replication in E. coli a. ___________ initiator of replication by binding to the origin of replication of the prokaryote ___________ a dimer that unzips the DNA helix ___________ an enzyme responsible for relieving positive supercoils ahead of replication fork ___________ maintains DNA in single-stranded state ___________ primary replicating enzyme ___________ synthesizes RNA primers The resulting gap by removal of RNA primer is filled in by ___________. h. the resulting nick is sealed by _____________.