Figure 2 illustrates a type of gene mutation.     a) State the type of gene mutation shown in Figure 2. b) Name the genetic disorder that would arise from this mutation. c) What is the difference(s) between gene mutation shown in Figure 2 from a frameshift mutation?

Q: What type of mutation occurred to produce the abnormal sequence (nonsense or missense)? Explain your…

A: A mutation is a change in a DNA sequence.

Q: What are frameshift mutations?

A: Mutations are the alternation or the changes that occur in the DNA. They are variations in codons…

Q: What is a mutation?

A: Mutation can lead to various disorders such as cancer and a wide range of genetic disorders.

Q: Briefly explain the frameshift mutation ?

A: Mutation can be defined as the change that occurs in the DNA sequence which is caused by mistake or…

Q: What is an insertion mutation?

A: Any permanent change in a sequence of DNA is termed a mutation. DNA is found in all organisms, and…

Q: How to create precise nucleotide or single-gene mutations or deletions ?

A: Each nucleotide is comprised of sugar, a phosphate gathering, and a nitrogenous base. The sugar is…

Q: Is the mutation in the sickle cell gene a point mutation or a frameshift mutation?

A: Point mutations are a large category of mutations that describe a change in single nucleotide of…

Q: What is the receptor for the targeting sequence?

A: Proteins synthesized by ribosomes include soluble and membrane proteins of the Endoplasmic Reticulum…

Q: What is a retromer?

A: Cell surface receptor are the receptor that are embedded in the plasma membrane of cells. They act…

Q: what is a palindromic sequence?

A: If a nucleic acid sequence in a double stranded DNA or RNA molecule is read in a particular…

Q: Define the Okazaki fragments ?

A: The biochemical molecule that is built up with two polynucleotide chains is called DNA…

Q: What are the components needed for the processes of transformation, conjugation, and transduction?…

A: 1.The genetic transfer in bacteria happens through three major processes.They are:…

Q: What different methods were used to help break the genetic code? What did each method reveal and…

A: The genetic code is a triplet code, in which three nucleotides encode each amino acid in a protein.…

Q: Why are temperature-sensitive mutations useful for uncovering thefunction of a gene?

A: Mutations are alterations in the DNA sequence due to the mistakes during cell division, exposure to…

Q: Identify (circle the mutation in the mutated sequence) and name the type of mutation that occurred.

A: # Here I have given solution of mutations only , please send next question related to genetics…

Q: How were chaperones discovered?

A: Molecular chaperons are proteins that assist the conformational folding or unfolding and the…

Q: Explain what happens in frameshift mutation? Name one disease caused by the disorder?

A: Addition or deletion of nucleotide in protein coding region of gene can shift the translational…

Q: If the mutation causing Tay Sachs disease involves a C to T change at position 4 in the sequence…

A: Gene probes are of three types: gene-specific probes, polymorphic probes and oligonucleotide probes.…

Q: Why do frameshift mutations tend to have a more severe consequence than a missense mutation?

A: Mutation is change in a DNA sequence. Mutations can result from: DNA copying mistakes made during…

Q: For the following five sequences, what is the consensus sequence? 5′–GGGAGCG–3′ 5′–GAGAGCG–3′…

A: Consensus sequences models are most used methods for sequencing base sequences. Consensus sequences…

Q: Would a gain of function mutaion that occurs in the first exon of a gene with twelve exons more…

A: Gain-of-function type of mutation is a mutation in which the altered gene product possesses a new…

Q: What is a restriction fragment?

A: A restriction fragment can be defined as the amount of  DNA fragment which occurs due to the cutting…

Q: How long is the COI gene?

A: A gene is a stretch of nucleotides present in the DNA molecule. It encodes information for the…

Q: TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense…

A: ORIGINAL:- TGAGGATGAAACTCACACCGGGGCGCAAGTTTGGCACTTAGATTCTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT…

Q: What are gene chips ?

A: Gene chips, also known as DNA microarrays, are powerful tools used to measure gene expression. By…

Q: What are contiguous fragments ?

A: Using complementary sequences that have been synthesised & combined to create a mixture of…

Q: What is the resulting polypeptide: _______________________________________________________? What…

A: Central dogma is the central processing part in which DNA is converted into m RNA by transcription…

Q: hat type of  mutation (missense, silent, and non-sense) was introduced in your sequence when G was…

A: A Mutation happens once a deoxyribonucleic acid sequence is broken or modified in such the simplest…

Q: TACAT

A: Solution :There are three types of DNA Mutations: base substitutions, deletions and insertions.

Q: Can you briefly explain each types of mutation (difference, unique fact, etc) ? Please don’t just…

A: Mutations are the changes in the genome resulting in the synthesis of different products. These…

Q: how are okazaki fragments created?

A: An Okazaki fragment refers to DNA fragments that are formed during the DNA replication process.

Q: What is the principle of Sanger sequencing?

A: DNA sequencing is the process of determining the sequence of nucleotides (adenine, guanine,…

Q: What is the resulting polypeptide: _______________________________________________________? What…

A: Polypeptide It is defined as the polymer of amino acids that are attached together by the peptide…

Q: What is Kozak sequence ? who invented this ?

A: Introduction  The process of transcribing the mRNA into protein is called Translation. There are 3…

Q: What is fusion mutation?

A: Introduction Mutation can be defined as the change in the DNA sequence or a structural change…

Q: What type of mutation is shown below:

A: Structural chromosomal mutations refer to the changes in structure of a chromosome due to insertion,…

Q: What is a mutation of a gene?

A: Gene is the unit of hereditary which is transferred from one generation to another and posses the…

Q: What are frame-shift insertion?

A: Mutations are changes that occurs in the deoxyribonucleic acid (DNA) sequence, either due to…

Q: What is a Sanger Sequencing ?

A: The term DNA sequencing encompasses biochemical methods for determining the order of the nucleotide…

Q: What is targeted mutation?

A: Mutation means sudden changes occur in DNA sequences. The mutation occurs randomly. It also occurs…

Q: What is a silent mutation? Why is the name “silent mutation” a bit of a misnomer?

A: The flow of information in the cell is generally from DNA to RNA to proteins. DNA contains the…

Q: What specifies the modified sequence of nucleotides found in an edited RNA molecule?

A: Translation is the process of translating the sequence of a messenger RNA (mRNA) molecule to a…

Q: What is a deletion mutation?

A: The mutation is a sudden, stable, and heritable change in the organism’s genome. It can occur due to…

Q: If the gene undergoing protein synthesis consists of 24 bases, how many codons does that result in?…

A: In genetic code a unit known as codon, which codes for amino acid. For example the sequence AUG is a…

Q: Which type of mutation results in abnormal amino acid sequence?

A: Mutation is typically the change in the sequence of the DNA. The DNA sequence of a gene can be…

Q: How many base pairs are changed in the sickle cell mutation?

A: in sickle-cell anemia, the gene for beta globin is mutated. As a result the mutated protein is…

Q: What is the nature of the prion mutation that leads to extreme sensitivity to prion disease?

A: A misfolded protein can be defined as a protein that cannot get back to its normal native state due…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.