Q: In cats, fur color is a sex-linked trait, where black fur is dominant over yellow fur. If a calico f...
A: Genetics is the discipline of science concerned with the study of genes and their transmission from ...
Q: What are the two key concepts for this section?Define freshwater. Explain why access to water is ahe...
A: Water is a vital resource that is essential for human survival, health, and economy. Access to clean...
Q: In a population of geese, the narrow-sense heritability for wing span is shown to be 0.5. If the phe...
A: The formula that can be used to calculate narrow-sense heritability is equal to: h2=VAVP Here h2 eq...
Q: How does the body restore normal blood calcium levels during a state of hypocalcemia (low blood calc...
A: The body maintains a tight grip on the amount of calcium circulating in the blood at all times. This...
Q: Direction: Determine the principal action of the hormones in Column A. Identify its major action (Co...
A: The above mentioned hormones play an important role in the reproductive system of males and females....
Q: A.) Deletion mutation is a loss of a single base by damage. B.) Point mutation is when a nucleotide ...
A: "Since you have asked multiple question, we will solve the first question for you. If you want any s...
Q: How do we know that the lac repressor is a protein?
A: Lac repressor protein is encoded by the lac I gene.
Q: WORD FILL INS a) All chordates as embryos have the start of gills- what are these called? ____ pouch...
A: Vertebrates, tunicates, and lancelets are all members of the Chordates (Chordata) family of animals....
Q: Most of the carbon dioxide that plants use for photosynthesis comes from______ . a. glucose c. rainw...
A: photosynthesis is the process that plants use to turn carbon dioxide and water into glucose and oxyg...
Q: What type of molecule is shown here? Give its biological importance? ÇH2OH но OH test question 3.png...
A: It is the structure of glucose molecule. It is present in pyran ring form. So it is called gluco...
Q: . An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show ...
A: The malting temperature (Tm) of the DNA is the temperature at which at least 50% of dsDNA is conver...
Q: Explain your answer. Below is a pedigree showing the inheritance of colorblindness in Akoto family. ...
A: Colorblindness is a X-linked recessive disorder. X-linked recessive disorders are those which are pa...
Q: Compare the cyclic and noncyclic light-dependent reactions
A: Introduction: As the anabolic reaction that transforms solar light energy into cellular chemical ene...
Q: Why didn't photosynthesis progress earlier in the Archaean?
A: Photosynthesis is the cellular process by which plant use sunlight for sun, water from soil, and Co2...
Q: Explain how fog forms off the San Francisco coast. For a complete answer, you need to use the follow...
A: The term fog is associated with the cloud that is comparatively closed to ground than to the sky. Fo...
Q: Explain which type of isolating mechanism this would be once you determine the barrier type?
A: Isolating mechanisms are the processes by which groups of organisms become isolated long enough to g...
Q: ystic fibrosis (CF) is an autosomal recessive condition triggered by the overproduction of sticky mu...
A: Suppose the alleles affecting CFTR protein formation are AA, aa being homozygous recessive and hence...
Q: 3. How can one use a pedigree chart to hypothesise how a certain condition is transmitted? Can a ped...
A: Pedigree shows relationship between family members and indicates which individual have certain genet...
Q: Match each item in column A with an item in column B. Write the letter of the correct answer on the ...
A: Humans are either left-brained or right-brained, according to this notion, implying that one half of...
Q: Sex-linked inheritance
A: Glucose-6-phosphate dehydrogenase deficiency/G6PDD (g) is an X-linked recessive condition. Fragile ...
Q: You want to breed an apple tree that produced apples with no seeds, yet keeps the specific apples of...
A: Introduction:- An autopolyploid has an additional set of chromosomes that are identical to the paren...
Q: Why do you need to lest the null hypothesis instead of just proving an alternatine bypothesis?
A: A null hypothesis is a claim that no link exists between two variables. An alternate hypothesis is a...
Q: what is an enzyme
A: Proteins are the building blocks of the body. It plays an essential role in the body. Proteins are m...
Q: What are the various names of articulations based on movement?
A: Articulation is a joint between bones or cartilage in the skeleton of an animal. Joints or articul...
Q: Standard of precautions provide guidelines for the purpose of; I. Eliminating the source of infectio...
A: Standard of precautions provide guidelines to prevent spreading of disease transmission (patient to ...
Q: what advantages do regulatory systems provide to the organisms?
A: Introduction :- The neurological system and the endocrine system work in tandem to control and coord...
Q: Explain what might happen in the food web if snakes were removed from the ecosystem Snake Frog Rabbi...
A: An ecosystem is defined as a structural and functional unit of ecology where plants, animals, and ot...
Q: Why is cholesterol important in the human body?
A: Sterols are substances that lack fatty acids yet possess fat-like characteristics. Each sterol is ma...
Q: A homozygnous Dominant brown mouse is crossed with a heterozynous Brown mouse(tan is ressesive color...
A: A gene is a piece of DNA that contains the instructions for a specific feature or attribute. Heteroz...
Q: What would be the sequence that the RNA polymerase synthese from the follwing DNA sequence? 5' ACCT...
A: Transcription: The process of formation of RNA from the DNA by action of DNA dependant RNA polymera...
Q: Describe what happens when a pigment that is part of a lightharvesting complex absorbs light.
A: Photosynthesis is the conversion of light energy into chemical energy by phototrophs, which is then ...
Q: D. 6.The B blood-type allele probably originated in Asia and subsequently spread to Europe and other...
A: Aim: to know the concept about biological evolution, natural selection, genetic drift, analogy, and...
Q: and have no 6. Bacteria do not have a a. nucleus, cell membrane b. nucleus, organelles c. cell membr...
A: Answer 6- b. Nucleus, organelle Bacteria do not have a nucleus and have no organelle in them( except...
Q: For water to vaporize O energy must be supplied. both energy must be supplied and hydrogen bonds bro...
A: Introduction: The process through which a liquid state changes into a vapour state is known as vapor...
Q: B. Encircle Monophyletic groups that can be found in this tree. Angus cattle White-tailed deer Blue ...
A: Phylogenetic tree is a diagrammatic representation which evaluates how the taxons are closed related...
Q: an insect population lives on trees. over time, more trees with light colored bark grown in their ha...
A: Introduction:- Camouflage (noun) is defined as the act of concealing one's physical appearance. Camo...
Q: Why did it take so long for scientists to figure out that infections are caused by bacteria? What we...
A: Bacteria is prokaryotic microorganism.
Q: Which of the following effects is produced by the high surface tension of water? Group of answer...
A: Due to the cohesive nature of the water molecules, surface tension can be defined as a feature of a ...
Q: 1. How easy was it to predict the possible composition of the 1st filial and 2nd filial generations ...
A: The question is in past tense, as if some type of mono,di or tri-hybrid cross was given as a part of...
Q: How do we know that the trp operon is a repressible controlsystem, in contrast to the lac operon, wh...
A: Introduction The process by which the information contained in a gene is used to drive the assembly ...
Q: Viruses are capable of infecting bacteria by injecting their DNA into the bacterial cells. This was ...
A: Viruses are capable of infecting bacteria by inserting their DNA into the bacterial cell. This w...
Q: If RR stands for red, RR' stands for roan and R'R' stands for white; as well as B stands for bucking...
A: The Punnett square can be used to determine the genotypes in a cross or mating experiment.
Q: In flies, long wings (W) are dominant to short wings (w). Two homozygous recessive flies are crossed...
A: Given: In flies, long wings(W) are dominant to short wings(w). Dominant traits are always expressed ...
Q: A transport protein requires ATP to pump sodium ions across a membrane. This is a case of_______ . a...
A: The act or the means by which a molecule or ion is moved across the cell membrane or via the bloodst...
Q: Photosynthesis runs on the energy of_______ . a. light c. O2 b. hydrogen ions d. CO2
A: Introduction Plants need the green pigment chlorophyll to perform photosynthesis, which produces oxy...
Q: 8:25 Screenshot_2021120 What I Can Do Activity 6. What is your stand? Directions. Below are some of ...
A: A genetically modified organism (GMO) is any organism whose genetic material has been altered using ...
Q: 6. Create a Venn Diagram to show the relatedness of these organisms. Start with the trait that is sh...
A: Answer :: Step 1 of 3 :: Cladistic is a diagrammatic representation which determines evolutionary...
Q: Provide a proof that a different phenotype can be produced from the same genotype. What are the pos...
A: The collection of genes that make up a person's genotype is referred to as that person's genotype. I...
Q: 2. Brown eyes are dominant over blue eyes in humans. Having a peaked hairline is dominant over havin...
A: Homozygous - This is a genetic state in which a person inherits the same alleles from both parents f...
Q: A trait exhibits 100% concordance in both monozygotic and dizygotic twins. What conclusion can you d...
A: Answer- both genetic and environment factors are important
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- An ________ can help keep the pH of a solution stable. a. covalent bond c. buffer b. hydrogen bond d. free radicalIn ________ reactions, small molecules are linked by covalent bonds, and water can also form. a. hydrophilic b. hydrolysis c. condensation d. ionichich of the following is not a unique property of water? provide as means of lubrication have a high heat capacity act as a universal solvent due to it being a polar molecule form covalent bonds with other water molecules
- Why is it unlikely that two neighboring water moleculeswould be arranged like this?H HH HO OChanging pH, polarity and ionic strength of solutions cannot disrupt which of the following interactions between polypeptide chains? Electrostatic interactions Hydrophobic interactions Hydrogen-bonding interactions disulfide bonds none of theseWhich of the following interactions will be most UNAFFECTED at very high salt concentration or at saturation? Hydrophobic interactions (clustering of hydrophobic groups away from water) and van der Waals interactions CH CH, H,C CH, H,C CH, CH Polypeptide backbone Hydrogen bond C-OH CH-S S CH, CH2 Disulfide bridge - CH,-CH,-CH,-CH, NH, -O C-CH, lonic bond CopyegPon Econ p g n Cun A. H-bond O B. Hydrophobic bond O C. Disulfide bridge D. lonic bond E. None of these
- Which of the following is MOST soluble in polar solvents? A H₂C ОН В с D ОВ O О О O A H3C. HO HC CH3 CH3 ОН COOH CH3 CH3 CH3Which of the following is correct about the properties of water? Three of the qualified choices could serve as correct answers to the question It is an amphipathic molecule (Two of the qualified choices could serve as correct answers to the question) Its molecules are cohesive None of the qualified choices could serve as correct answers to the question It is an ambivalent molecule It is an asymmetric polar solvent amino a It demonstrates temperature-stabilizing capacities It is covalently linked with other water molecules by hydrogen bondsIn dehydration reaction between phosphate (derived from phosphoric acid) and glycerol (a sugar alcohol) accompanied with the removal of a water molecule, what chemical bond holds them together in a phospholipid molecule? Ether Bond Thioester Bond Acid Anhydride/phosphoanhydride bond Ester Bond
- Which of the following is responsible for water exhibiting properties such as adhesion, co- hesion, and a high surface tension? A B с D covalent bonds between the constituent atoms presence of oxygen in the water molecule shape of the water molecule hydrogen bondingIf a solution has an activity cofficient <1, which is true and why? -solution will not experience collagitive properties -ions must be present -solvent will effictively act as pure liquidWhat is the [OH-} concentration of a solution that has a pH of 3? O 10e^-3 10e^-10 O 10e^-11 10e^-1 none of the above