Which type of membrane transporter requires a gradient to move molecules across the membrane? O Voltage-gated channels Leak channels O Ligand-gated channels All of the above require a gradient None of the above require a gradient

Which type of membrane transporter requires a gradient to move molecules across the membrane? O Voltage-gated channels Leak channels O Ligand-gated channels All of the above require a gradient None of the above require a gradient

Human Physiology: From Cells to Systems (MindTap Course List)

9th Edition

ISBN:9781285866932

Author:Lauralee Sherwood

Publisher:Lauralee Sherwood

Chapter3: The Plasma Membrane And Membrane Potential

Section: Chapter Questions

Problem 2TAHL: Assume that a membrane permeable to Na+ but not to Cl- separates two solutions. The concentration of...

See similar textbooks

Related questions

Q: What are three aspects of your lifestyle that mightdirectly or indirectly contribute to decline in E...

A: Honeybees and many other insects are natural pollinators of a large number of plant species.

Q: 2. Why are paraphyletic groups considered as bad groups in a phylogenetic tree?

A: According to the question, we have to explain the reason that the paraphyletic groups are considered...

Q: Coding sequences in a post-transcriptionally modified eukaryotic transcript codes for _____. a. Fix...

A: Coding sequence codes for functional protein products. Coding sequence codes for the functional prot...

Q: While doing research on deep-sea vents, you discover a very simple new life form. After some initial...

A: DNA is the fundamental component of our being. DNA is the carrier of information, it passes from one...

Q: Upon rotation the spinous went more to the left and to the left upon lateral flexion. What is the li...

A: The term spine is associated with the body’s backbone that is positioned on the dorsal side. In musc...

Q: What causes the lub-dub sound of a beating heart? A. Heart valves closing B. Muscles sliding against...

A: Answer- A. Heart valves closing. A healthy heart makes a lub-dub sound with each beat. This sound ...

Q: Describe how a natural disaster can create an ecological disturbance, and how this can impact biodiv...

A: A geographic area where plants, animals, and other organisms, as well as abiotic factors work togeth...

Q: Given the highly complex lipid composition of cell membranes, what are the variations within differe...

A: Cells are membrane-bound structure that contains the organelles of the living body. Some of the cell...

Q: 3. A pure line Black feather duck is crossed with pure line White feather duck. Consider the Black f...

A: Introduction: Law of Dominance states that dominant alleles always mask the recessive alleles. In he...

Q: 4. Comparative Morphology Data. Using your text and prior knowledge, determine the morphological cha...

A: Characteristics table attached below If character is present mark in "+", and if absent mark in '--'...

Q: a method a virus can use to prime DNA replication and give an example of a virus that uses this prim...

A: Viral Replication of double stranded DNA proceed in two phases first replication of early phase gene...

Q: Swimming just like any other exercise is accompanied by some risks of accidents. Therefore, it shoul...

A: Swimming ie considered as one of the main physical activities for making someone fit, both mentally ...

Q: Consider the endomembrane system. Explain how a CFTR protein would be produced/synthesized in a lung...

A: CFTR ( cystic fibrosis Transmembrane receptor) protein is help in regulation of chloride and sodium ...

Q: A science teacher wants to test the effectiveness of two types of learning strategies. She uses a fl...

A: Introduction A language learning strategy refers to the processes and actions that language learners...

Q: insect'

A: Insect are small animal with six legs, two pairs of wings and a body which is divided into three par...

Q: what advantages do regulatory systems provide to the organisms?

A: Introduction :- The neurological system and the endocrine system work in tandem to control and coord...

Q: Describe Affinities of ginkgoales.

A: Ginkgoales: Ginkgoales is a gymnosperm order with only one living species: the ginkgo tree, Ginkgo ...

Q: What parts of the cell contain DNA?

A: The genetic material of the cell is DNA, or deoxyribonucleic acid. It is the first nucleic acid to f...

Q: 3. How can one use a pedigree chart to hypothesise how a certain condition is transmitted? Can a ped...

A: Pedigree shows relationship between family members and indicates which individual have certain genet...

Q: Fcommercially sterile" and "axenic

A: Commercial sterilization is defined as the destruction of all pathogenic and spoilage organisms that...

Q: Explain in 500 words, the health policy in Benin country?

A: The Republic of Benin or Benin is located in western region of African continent.

Q: One way to characterise biological tissue is to send a small electrical current through the tissue a...

A: Q.

Q: Classify and diagram embryos on the basis of their: (a) yolk content, (b) cleavage types, (3) cleava...

A: Cleavage in animals is depends upon amount of yolk. Yolk distribution can be complete ( holoblastic ...

Q: PROBLEM SOLVING: In the human pedigree below, the filled symbols represent the affected individuals....

A: Genotype Genotype is the collection of all gene inside an organism.

Q: Functional Group Name Structural Diagram (draw all bonds) Found where in the body??? 7. 8. Sulfhydry...

A: Introduction:- Alcohol is dispersed throughout the body's fluids, exposing most tissues, including t...

Q: Help explain this LAPTM5 and LAPTM5 restrict HIV-1 infectivity

A: Answer

Q: 4. Distinguish among the three processes of genetic recombination in prokaryotes: a) transformation,...

A: Distinguish among the three processes of genetic recombination in prokaryotes: a) Transformation, th...

Q: List three general uses for industrial fermentation ethanol.

A: On an industrial scale, ethanol is produced by the fermentation of molasses. Molasses is the mother ...

Q: Why didn't photosynthesis progress earlier in the Archaean?

A: Photosynthesis is the cellular process by which plant use sunlight for sun, water from soil, and Co2...

Q: A homozygnous Dominant brown mouse is crossed with a heterozynous Brown mouse(tan is ressesive color...

A: A gene is a piece of DNA that contains the instructions for a specific feature or attribute. Heteroz...

Q: Study the graphs shown in the picture. Describe the patterns observed in the top group depicting ch...

A: Biodiversity refers to the variety of life on earth at ecosystem, genetic and species levels.

Q: Table 2. Starter plate conditions. Starter Plate Bacterial Cas9 DNA Repair System SGRNA Donor Plate ...

A: Q.

Q: taxonomical heirarchy

A: Taxonomic hierarchy is the process of arranging various organisms into successive levels of the biol...

Q: Give two examples of the benefits gained by theintroduction of nonnative species. Give two exampleso...

A: The species who show their origination as well as development in a particular surrounding can be des...

Q: Explain Affinities of Gnetales.

Q: Which parameter from the software must you adjust in order to permit gene flow? Starting frequency ...

A: Definition: Gene flow is the movement of gene from one organisms to another one. It can be in a hori...

Q: Why do you think Costa Rica (Core Case Study) hasset aside a much larger percentage of its land for ...

A: Costa Rica is a rugged, rainforest-covered Central American country with Caribbean and Pacific coast...

Q: . An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show ...

A: The malting temperature (Tm) of the DNA is the temperature at which at least 50% of dsDNA is conver...

Q: 1. Why is direct flaming preferred when disinfecting loops and needles? 2. Why is it important to fl...

A: 1.Direct flaming is preferred for disinfecting needles and loops because that completely kills all t...

Q: "Life has shaped earth just by existing”. In 2-3 sentences, explain this statement briefly by citing...

A: Life is a complex entity and it does not formed in just one day. Millions and millions of years too...

Q: Why is there a need to classify the great diversity and life?

A: Since you have asked multiple question, we will solve the first question for you. If you want any sp...

Q: TRUE OR FALSE. Studies have confirmed that damaged to both the double strands can be reversed via si...

Q: Explain why we say that photosynthesis feeds most life on Earth.

A: Plants absorb CO2 and water (H2O) from the air and soil during photosynthesis. Water is oxidized (lo...

Q: What provides the negative charge associated with DNA? The phosphate groups The nitrogenous bases Th...

A: DNA (Deoxyribonucleic acid) is a molecule that is made up of two polynucleotide chains that coil aro...

Q: 7. In simple terms, describe how crossing over is carried out. How does it generate variability?

A: The interchange of genetic material in the germ line is referred to as crossing over.During meiosi...

Q: 1. Photoreactivation destroys the covalent bond by using the light energy from the UV light source t...

A: Photoreactivation is the mechanism of DNA repair. This is a light-dependent repair mechanism. It in...

Q: The expression of antigen A or antigen B in red blood cells requires the help of an H antigen. A re...

A: Bombay phenotype is extremely rare in ABO blood group with an occurrence of 1 in 250000. It is an au...

Q: Perform the Fork-lined method of the given alleles. A male having a characteristic of TtSsYy and a ...

A: Genetics is the study of the functioning and main codes of variation and heredity. Inheritance is th...

Q: Which of the following effects is produced by the high surface tension of water? Group of answer...

A: Due to the cohesive nature of the water molecules, surface tension can be defined as a feature of a ...

Concept explainers

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.

Question

Which type of membrane transporter requires a gradient to move molecules across the membrane?
O Voltage-gated channels
Leak channels
O Ligand-gated channels
All of the above require a gradient
O None of the above require a gradient

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

What is an example of receptor/ligand binding? O Simple diffusion O A hormone binding to a receptor O None of these is correct Facilitated diffusion O Active transport
When the nerves deliver a signal to contract, Ca++ (calcium ions) rush into the cell. The calcium ion influx causes specialized fibers to contract. Afterward, calcium ions are pumped out of the cell by calcium ATPases. What transport type(s) is occuring?s antiporter only ion gated transport followed by active transport active transport only ion gated transport only active transport followed by ion gated transport
Which of the following can be correctly applied to gap junctions? Select all that apply Allows small molecules and ions to travel between cells They are membrane channels that allow communication between neighboring cells O Prevents cells from separating from one another O They behave as gated ion channels
difference between channels and transporters is that O Only channels allow for the passage of solutes against their electrochemical gradient. OTransporters allow for a greater rate of transport across a membrane than channels do. O Only channels allow for the transport of ions. Transporters must undergo a conformational change upon binding to the solute.
In contrast to transporters and carriers, channels: O Are selective for the specific solutes (e.g., ions) they transport Require solutes (e.g., ions) to bind to them in order to be transported O Create pores through the membrane Saturate after reaching the maximum rate of transport
The abundant intercellular connections gab junction can be found in O diaphragm O Heart muscle O Skeletal muscle O Smooth muscle
Which of the following is FALSE regarding membrane transport? O A cell can add proteins into its membrane through the process of exocytosis O lons like Na+ or K+ do not enter a cell via simple diffusion O Hydrophobic molecules usually enter a cell via protein channels O lon channels must be integral proteins
In which way are voltage-gated ion channels and active transporters similar? a they are required to move small permeable molecules across cell membranes b they are proteins which move molecules across cell membranes c they utilize facilitated diffusion d they directly require energy in the form of ATP to move molecules e they generate concentration gradients
Which of the following is a characteristic feature of a ion channel protein in a plasma membrane? It is specific for a certain type of ion. It works against diffusion. It is a peripheral membrane protein.
Enzyme linked receptors: Function directly as enzymes or they are linked to enzymes O Are surface receptors O Are trans-membrane proteins O All of the above Which of the followings is CORRECT about osmosis of water?
Insulin is a protein hormone that signals liver and muscle cells to lower blood sugar levels via cell uptake of glucose. If the blood glucose concentration is 0.3 M glucose and a muscle cell's glucose concentration is 0.15. What is the most likely mechanism of uptake of glucose in that muscle cell? active transport O simple diffusion O facilitated diffusion via a channel protein O facilitated diffusion via a carrier protein
If the intracellular concentration of sodium ions in a cell is 5 mM and the extracellular concentration is 140 mM, which of the following would be TRUE? a at room temperature the equilibrium potential of sodium would be -84 mV b if the cell was only permeable to sodium its membrane potential would be negative c sodium ions would tend to move by simple diffusion into the cell d all of the above e none of the above