Answered: Explain why a 50S ribosomal subunit and…

Explain why a 50S ribosomal subunit and a 30S ribosomal subunit combine to form a 70S subunit, instead of an 80S subunit

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section13.4: Translation

Problem 11LO

See similar textbooks

Related questions

Q: includes

A: A new Covid, known as serious intense respiratory disorder Covid 2 (SARS-CoV-2), is the aetiological…

Q: Compare and contrast cotranslational import of polypeptides with posttranslational import of…

A: Import of polypeptides across the membrane bilayer refers to the translocation process. The…

Q: Why would 60S and 40S ribosomal subunits make an 80S ribosome rather than a 100S ribosome?

A: Ribosomes are the non-membrane bound cell organelles and these are responsible for the protein…

Q: Name the GREEN structure of the tRNA Variable loop D-loop Anticodon loop Pseudouridine loop

A: According to the messenger RNA (mRNA) nucleotide sequence, transfer RNAs (tRNAs), also known as…

Q: threonine, alanine, and isoleucine. The TRNA anticodons for the amino acid sequence shown above is…

A: Protein synthesis or translation process takes place on the ribosomes with the help of messenger RNA…

Q: CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5

A: Genetic codes are read in the form of triplets.first we will convert them to the triplets and then…

Q: What are the subunit interactions that account for the properties of ATCase?

A: Enzymes help to speed up various chemical reactions occurring in a human body as they are also known…

Q: Write the names of the appropriate regions on L-shaped structure of TRNAS. 13' 15'

A: The process of protein synthesis involves transcription and translation. In transcription, DNA is…

Q: Define messenger ribonucleic acid (mRNA)

A: Answer: Introduction: RNA molecule consists of four nucleotide bases these are adenine (A), cytosine…

Q: Describe the chemical differences between a ribonucleoside triphosphate and a deoxyribonucleoside…

A: Ribonucleotide triphosphate (RNTPs) and Deoxyribonucleotide monophosphate they are used in…

Q: Define aminoacyl tRNA synthetase

A: Nucleic acids are biological macromolecules that are essential to all known forms of life as they…

Q: RNA polymerase subunits comprising the core enzyme are a.α b.β c.δ d.σ e.ω

A: RNA POLYMERASE It is a multi-subunit enzyme. It is composed of five subunits…

Q: What are the two major molecules that make up ribosomal subunits? Recalling information from chapter…

A: Ribosomes are macromolecules found in abundant quantities in the cells of living cells. An actively…

Q: During Chain ________ Each Incoming Aminoacyl-tRNA Moves Through Three Ribosomal Sites.

A: The process of translation is the process by which the information stored in the DNA is converted…

Q: Using threonyl-tRNA synthetase as an example, account for the specificity of threonyl-tRNA…

A: Introduction: Enzymes are the catalysts that increase the rate of the reaction that occurs inside…

Q: An anticodon on a TRNA has the sequence 3' UAC 5. What amino acid would it be charged with?

A: The tRNA is the transfer ribonucleic acid and it helps to decode the information present in the mRNA…

Q: From this overall anticodon sequence in tRNA,…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: The tRNA having a cloverleaf structure suggests the following features EXCEPT

A: Answer - It is a single stranded linear structure with protein coding sequences.

Q: explain and show Clover leaf model of tRNA

A: Transfer RNAs (tRNAs), also called “soluble RNAs” (sRNAs) are small molecules varying from 73 to 93…

Q: Consider à ollowing sequence: His-Cys-Leu-lle-Met where Met is at the C-terminus end. Based on the…

A: Amino Acids are are structures linked by Peptide Bonds to Form Polypeptide Chains. Proteins are…

Q: The ribosome can transfer any peptidyl group from the P-site tRNA to any aminoacyl group on the…

A: Proteins or polypeptides are sequence of amino acids which are linked by peptide bond or amide bond.…

Q: subunlt Small subunit 5' 3' MRNA For our Unit 12 discussion on gene expression, please answer the…

A: The genetic code is essentially a collection of "rules" that a cell utilises to decipher the…

Q: From this overall anticodon sequence in tRNA,…

A: Anticodon present on the tRNA and it is read in the direction 3'→5' which is complementary to the…

Q: Describe how the base pairing between the Shine–Dalgarno sequence and the 30S subunit provides a…

A: The translation represents the process of protein synthesis by which the base sequence of the mRNA…

Q: How many moles of ATP and GTP are required to synthesize a mole of a polypeptide 100 amino acids…

A: In protein biosynthesis, amino acids are activated by the binding of a specific tRNA molecule and…

Q: What is the role of the 50S ribosomal subunit in prokaryotic protein synthesis?

A: The ribosome is considered as an important organelle for protein synthesis. The prokaryotes have 70s…

Q: Describe charging of tRNA or aminoacylation of tRNA.

A: Transfer RNA or tRNA is a special type of RNA, which is useful in decoding the sequence of messenger…

Q: Describe the chemical differences between a ribonucleotide triphosphate and a deoxyribonucleotide…

A: Nucleotide are group which form DNA or RNA .It generally consists of :- A ) Nitrogenous base B )…

Q: Can a tRNA exist that has the anticodonsequence 5′ IAA? If so, which amino acidwould it carry?

A: Transfer RNAs (tRNAs) are essential in protein synthesis and elongation. The sequence on the mRNA…

Q: which level of structure describes non watson crick intercations in trna

A: According to Watson and crick, the DNA is a nucleotide, it is made up of sugar, nitrogenous base,…

Q: Suggest which part of this sequence belongs to the inner part of the protein and which to the outer…

A: Proteins are polypeptides formed of monomeric units-amino acids. There are 20 different amino acids…

Q: Eukaryotic messenger RNA includes a poly A tail. When the poly(A) tail is less than approximately 30…

A: Introduction Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that, in molecular…

Q: What features of tRNA structure are involved in recognition and amino acylation by an aaRS?

A: Transfer RNA also called amino acid acceptor RNA, adaptor RNA, or soluble RNA is the RNA that…

Q: Name the three forms of ribonucleic acid (RNA) and describe their structures. Discuss how these…

A: The base sequences of RNA can be determined by knowing the base sequences of DNA as the information…

Q: Describe the components of eukaryotic ribosomal subunits and the location where the assembly of the…

A: Ribosomes are small particles which of RNA and associated proteins that function to synthesize the…

Q: The term subunit can be used in a variety of ways. What is the difference between a protein subunit…

A: Protein is considered as the building block of the body and it is required for the development of…

Q: =Suggest, which part of these sequence referred to inner core of the otein/ outer core (use single…

A: Hydrophobic: A, C, I, L, M, F, W, V. Neutral: G, H, P, S, T, Y. Hydrophilic: R, N, D, Q, E, K

Q: Please describe the enzyme - mediated reactions required for a histidine, freely floating in the…

A: Histidine is a amino acid which is used in protein biosynthesis. The biosynthesis of histidine…

Q: In the early days of research on protein synthesis, some scientists observed that their most highly…

A: Some scientists recognized that most highly purified ribosome preparations containing single…

Q: The a chain of eukaryotic hemoglobin is composed of 141 amino acids. What is the minimum number of…

A: There is an intimate connection between genes and synthesis of polypeptides or enzymes. Genes are…

Q: The Hemagglutinin protein in Influenza virus contains a remarkably long a- helix (7.95 nm) with 53…

A: Option H, 14.7

Q: Explain the contribution of features of the beta-sheet to the stability of the protein.

A: Proteins are unbranched polymers constructed from 22 standard α-amino acids. They have four levels…

Q: Describe the major structural features of tRNA.

A: Ribonucleic (RNA) nucleic acid, which is of three main types such as mRNA, rRNA, and tRNA and all…

Concept explainers

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.

Question

Explain why a 50S ribosomal subunit and a 30S ribosomal subunit combine to form a 70S subunit, instead of an 80S subunit

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

Describe the components of eukaryotic ribosomal subunits and the location where the assembly of the subunits occurs within living cells.
The term subunit can be used in a variety of ways. What is the difference between a protein subunit and a ribosomal subunit?
Ribosomal proteins have high pI values. Why is this advantageous for ribosome stability?
For the m-RNA nucleotide codons given below, what is the corresponding sequence of amino acids? AUG UGU AUA UAU GUA AUC ACC UUC UAU GUA ACA UUU UGG AAC AGC UGC CAU GUA UAC CAG AAA CUU GCA GAG CUG GCU UUG AUA UGA The α-helices are known to contain primarily the amino acids methionine, alanine, leucine, glutamate, and lysine, while β-pleated sheets are known to primarily contain the amino acids tryptophan, tyrosine, phenylalanine, isoleucine, valine, and threonine. Which one of these two types of secondary protein structure is present with this amino acid sequence?
On average, how many phosphoanhydride bonds (P;-P; bonds) are directly hydrolyzed in thecourse of synthesizing a 200 amino acid protein? Assume that you begin with the mature mRNA,ribosomal subunits, tRNAs, free amino acids, and all necessary factors.
The infectious prion protein which are believed to cause a neurodegenerative disease by acting as a template to misfold other cellular prion proteins are usually β-helices. Is this correct or not?
Ornithine is structurally similar to lysine except ornithine’s side chain is one methylene group shorter than that of lysine. Attempts to chemically synthesize and isolate ornithinyl-tRNA proved unsuccessful. Propose a mechanistic explanation. (Hint: Six-membered rings are more stable than sevenmembered rings.)
In the tertiary structure of tRNA, where is the anticodon region relative to the attachment site for the amino acid? Are these located adjacent to each other?
Consider the following in light of the concept of levels of structure (primary, secondary, tertiary, quaternary)as defined for proteins.(a) What level is shown by double-stranded DNA?(b) What level is shown by tRNA?(c) What level is shown by mRNA?
Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…
EF-G is a macromolecular mimic of EF-tu. It's role in translation is to To cause the large subunit of the ribosome to disassociate with the small subunit of the ribosome Bind to the vacant A-site subsequent to peptide bond formation and resolve the hybrid state of the ribosome To recruit the signal recognition particle (SRP) to the ribosome and to facilitate synthesis of membrane proteins O To cause the large subunit to associate with the small subunit of the ribosome Shuttle an amino-acylated tRNA to the A site to initiate the peptidyl transfer reaction
Consider the following in light of the concept of levels of structure (primary, secondary, tertiary, quaternary) as defined for proteins. (a) What level is shown by doublestranded DNA? (b) What level is shown by tRNA? (c) What level is shown by mRNA?