Explain the importance of primers in pinpointing the region of DNA to be amplified, and discuss why primers make PCR such a powerful and useful process. 4.
Q: How important and useful to the cell is the ability of the DNA to assume various forms? Why are…
A: Topic: an essay on " Ability of DNA to assume various forms and their importance ".
Q: 50 words essay on how important to have an adequate knowledge of biochemistry in understanding…
A: The branch of science that deals with the chemical substances and the processes involving them, that…
Q: Compare the process of polymerase chain reaction (PCR) to DNA replication. Discuss three…
A: PCR is in vitro process whereas DNA replication is in vivo process.
Q: Which statement about transcription is correct? O RNA polymerase synthesizes DNA from a DNA…
A: Transcription is defined as the process of copying a DNA template to produce an RNA. Whereas…
Q: DNA polymerases used in PCR _______.
A: The polymerase chain reaction (PCR) is a technique in which millions of copies of the desired DNA…
Q: Compare and contrast the use of the word recombinant as used in the phrases (a) “recombinant DNA”…
A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via a…
Q: explains how the underwinding of a B-DNA helix might facilitate or stabilize the formation of Z-DNA
A: Dideoxy ribonucleic acid (DNA), ribonucleic acid (RNA), and proteins play an essential role in the…
Q: Compare and contrast the activity of a topoisomerase and a helicase in the context of DNA…
A: The process of replication of DNA is a semi-conservative method, which suggest that the parental…
Q: Use the single strand of DNA below to answer the next two questions: 5' AGTTACCT 3 What is the base…
A: In biology, the word gene is the fundamental unit of heredity. Genes are composed of…
Q: Which is the leading template for replication? O 3' GTTAGTCTA-5" 5' GTTAGTCTA-3
A:
Q: evaluate the safeguards used in research using genetic engineering.
A: Genetic engineering is a process in which recombinant DNA is used to alter the genetic material…
Q: a) Explain the difference between a genome and a transcriptome. Do all cells in an organism have the…
A: The branch of biology includes the study of genes, their variation, and inheritance in organisms.…
Q: Write a short essay that explains how recombinant DNA techniques were used to identify and study…
A: DNA segment carrying information from parents to the offspring is called a gene. It is a determinant…
Q: Deine the term genomics.
A: A gene, composed of DNA, carries hereditary information that is passed from one generation to the…
Q: Predict how changes in base sequence can be used to test for genetic disorders.
A: Changes in base sequence is called mutation Exmaple - a change in single base pair is called point…
Q: How are "sticky ends" generated in DNA? A) by gel electrophoresis O B) by cutting with restriction…
A: Sticky ends or the conhesive ends are the overhangs created in a Dna strand, generally using an…
Q: Answer the two parts of the question. a) Explain what gene therapy involves. b) Discuss how gene…
A: Gene therapy presents one of the best technical difficulties in current medicine. It is…
Q: Use the figure of a plasmid below to answer the following questions. 43) Which enzyme was used to…
A: Bacteria contain Chromosomal DNA as a genetic material but apart from that it also possess rounded…
Q: Which is an application of genetic engineering
A: Genetic engineering permits researchers to move desired genes from one plant or creature into…
Q: Compare and contrast B DNA and Z DNA.
A: DNA (deoxyribonucleic acid) molecule structure is double helical. This structure of DNA was…
Q: The structure of DNA revealed how information is stored in the base sequence along a DNA strand. But…
A: DNA or deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around…
Q: Answer the above question for CutVI if the starting DNA were linear instead of circular.
A: Restriction enzymes are enzymes that identify specific sequences in DNA and cut DNA at or near these…
Q: Compare and contrast DNA methylation with DNA acetylation.
A: DNA methylation: DNA methylation is a biological process that involves the addition of methyl groups…
Q: a. Explain why the PCR is unlikely to amplify contaminatingbacterial DNA in a sample of human DNA.…
A: PCR stands for Polymerase Chain Reaction. It is fast and inexpensive technique which is used to…
Q: answer concisely in your own words. Relate the DNA structure to its role as a molecule for…
A: Dna is a double helical structure having sugar, phosphate and bases in its structure. This helicity…
Q: use the terms RNA primase dna polymerase helicase leading strand and lagging strand to briefly…
A: DNA is the genetic material . It is made of four deoxy nucleotide via phosphodiester bonds .
Q: Compare and contrast the use of the word recombinant asused in the phrases (a) “recombinant DNA” and…
A: Introduction:- Deoxyribonucleic acid, or DNA, is a molecule that contains the genetic instructions…
Q: Compare and contrast DNA replication and PCR.
A: Dna replication is the process of Synthesis of new daughter dna molecules or duplication of parent…
Q: DNA polymerases used in PCR
A: The polymerase chain reaction (PCR) is a method for rapidly producing millions of copies of the…
Q: to check DNA mole
A: Recombinant DNA technology known as "bacterial transformation" is used to introduce a gene of…
Q: Question 2 Cutting DNA into various size fragments is part of... Genetic fingerprinting Genetic…
A: Answer
Q: Examine the diagram carefully, and then answer the question below. vii VII i V iv vii Which one of…
A: Q. Which one of the following gives the correct names for the protein above ? Answer - (C) Helicase…
Q: Which is the dominant form of DNA found in the cell? H 2. Z 3. B 4. A
A: DNA is a deoxyribose sugar made up of different nucleotides. DNA is of three types: A-DNA, B-DNA and…
Q: Vho first developed the DNA sequencing approach using dideoxynucleoside triphosphates in DNA…
A: DNA was major topic of discuss in early times for scientists. It's structure and constituents…
Q: Removes RNA primer and replaces it with newly synthesized DNA.
A: A primer is a single-stranded nucleic acid that all living organisms utilize to start the production…
Q: mutat
A: Mutation- when a DNA gene is damaged or changed in such a way as to alter the genetic message…
Q: Biologists hypothesize that transposons eventually lose the ability to replicate and therefore…
A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA…
Q: Explain how the properties of DNA determine howit moves through a gel, is cut by restriction…
A: DNA stands for deoxyribonucleic acid. It is the genetic material of the organisms that transfer from…
Q: Second part asks: Explain the roles two of those enzymes would play in obtaining the recombinant…
A: As the second part is asked, so we are answering question 5 only. Genetic engineering, often known…
Q: How restriction sites help in the cloning process
A: DNA cloning is the process in which the desired DNA fragment is selectively amplified resulting in a…
Q: To determine: The reason due to which scientists think that new genes arise by the duplication of an…
A: The basic structure and functional unit of heredity is the gene. Diversity allows genes to evolve…
Q: a. Describe the ingredients of a PCR reaction.
A: PCR is used for amplification of DNA or to make multiple copies of DNA. PCR is used in forensics,…
Q: deceibe Addition and subtraction of DNA sequences
A: The errors in DNA sequence during the cellular process like replication, transcription result in…
Q: Analyze and describe the different types of genetic mutations and their effects. Then discuss, in…
A: A gene is a DNA sequence that contains genetic information for one functional protein. Disrupting…
Step by step
Solved in 3 steps
- What information and materials are needed to amplify region of DNA using PCR?After a polymerase chain reaction (PCR), agarose gel electrophoresis is often used to: a. amplify the DNA. b. convert cDNA into genomic DNA. c. convert cDNA into messenger RNA. d. verify that the desired DNA sequence has been amplified. e. synthesize primer DNA molecules.10. Taq polymerase, a DNA polymerase derived from thermophilic bacteria, is used in polymerase chain reactions (PCR) in the laboratory. During PCR, Taq catalyzes DNA polymerization, similar to how it would in bacteria. A normal PCR cycle is as follows:1. Melting/Denaturing 95°C2. Primer Annealing 50°C3. Elongation of DNA (repeat 20–30 cycles) 72°C Which of the following conditions likely describes the living environment of Taq bacteria?(A) Freshwater with acidic pH(B) Hydrothermal vents reaching temperatures between 70– 75°C(C) Hot springs of 40°C(D) Tide pools with high salinity
- 1. What is the function of the DNA polymerase enzyme in the PCR? 2. What natural process is PCR based on?1.Briefly explain the rationales of adding chemicals that can affect DNA stability in a polymerase chain reaction (PCR). 2.Why DNA melting is required in PCR? Briefly explain how PCR can be used to detect DNA mutation.5. After extracting your DNA from your cheek cells, we will add a solution called Master Mix to your DNA sample. One important component of the Master Mix are the "oligonucleotide primers" (or "primers" for short). What is the importance of these primers to the PCR process? 6. How did Taq DNA polymerase acquire its name? What is the job of this enzyme? Why aren't we using human DNA polymerase? briofly summarize in
- 1. How do we describe the two strands of DNA, once they have separated during denaturation? 2. Polymerase Chain Reaction requires both forward and reverse primers. Where do each of these primers bind? 3. What is the purpose of the primers in a PCR reaction? 4. PCR separates molecules using what property of DNA? Based on this, which direction do DNA molecules travel through a gel? (to the positive end? Or the negative end?) 5. What does ‘qPCR’ stand for and how is it different from regular PCR?1. What happens in the denaturing step of PCR? A. What happens during the annealing step of PCR? B. What happens during the extension step of PCR? C. What temperatures is associated with each PCR step? D. Why is it necessary to have a primer on each side of the DNA segment to be amplified? (Hint: draw it out to see what happens with only one primer). E. How did the Taq DNA polymerase acquire its name? F. Why are there nucleotides (A, T, G, C) in the master mix? What are the other components of the master mix and what are their functions?Part 2. PCR 1) In one color, write out the forward primer (5’ GATAC 3’) in the correct position relative to the given template DNA sequence. In a second color, act as the polymerase and fill in the rest of the new strand of DNA Primer/New Strand Template DNA: 3’ TAGCTATGCGGACCTCATGCATTAGAGTAG 5’ Part 3. Restriction Enzymes 1) Consider the sequence of DNA given below and answer the following questions 5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ a) You cut the sequence of DNA shown above using BamHI (see table 19.1 from the text). How many fragments of DNA would you expect to result from this restriction digest? b) If you cut the sequence of DNA shown above using BclI (recognition sequence = 5’ TGATCA 3’, enzyme cuts after the first T) instead of BamHI how many fragments do you expect? 2) For each given sequence/restriction enzyme pair, determine how many pieces of DNA would result form the digest and…
- 1. Describe and contrast the common steps of DNA replication in vivo and the PCR reaction in vitro? 2. What is the role of Nucleotides in DNA replication?8. To amplify a DNA fragment, your friend claims that the order of steps in a PCR is the following: Denaturation Elongation → Annealing You strongly disagree with her claim. In your own words, explain what would happen if a PCR follows that incorrect order and how that change would affect the outcome. Hint: would the DNA fragment be amplified? Why or why not?.1. What are the reaction components, and what equipment do you need for PCR?2. What can be possible source of DNA for PCR?3. What are some uses for PCR?