The structure of DNA revealed how information is stored in the base sequence along a DNA strand. But what information is stored and how is it expressed?
Q: DNA is a chemical that cells use to store information. Describe how information is encoded in DNA,…
A: DNA is Deoxyribo Nucleic Acid which is a complex molecule which consists of two polynucleotide…
Q: The diagram shows an important biological molecule going through the process of replication. Which…
A: Answer: REPLICATION OF DNA = It is one of the important process of central dogma in which DNA is…
Q: explains how the underwinding of a B-DNA helix might facilitate or stabilize the formation of Z-DNA
A: Dideoxy ribonucleic acid (DNA), ribonucleic acid (RNA), and proteins play an essential role in the…
Q: _________ unwinds DNA.
A: DNA is the genetic material which is formed by the polymerization of nucleotides. DNA Store the…
Q: What regulates the process of transcription and translation; compare and contrast these processes.
A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…
Q: Choose the combination of answers that most accurately completes the statement. Messenger RNA is…
A: Genetics is the investigation of heredity. Heredity is a natural interaction whereby a parent passes…
Q: Choose the combination of answers that most accurately completes the statement. DNA replication is…
A: Answer- DNA is semiconservative in nature, It was proposed by Francis Crick.
Q: Compare the base pair of DNA to the base pair of RNA?
A: Protein synthesis takes place within the nucleus and ribosomes of a cell and is regulated by DNA and…
Q: a) Are codons found in DNA or RNA? b) How many bases are in a codon? c) Give an example of a codon.
A: A codon is a DNA or RNA trinucleotide sequence that refers to a certain amino acid.
Q: Briefly describe what you know about the structure of DNA and how DNA is packaged in a cell.
A: Nucleic acid was first discovered by Freidrich Mieshcher and was previously called nuclein. Nuclein…
Q: Predict what might happen if the DNA that coded for a protein contained thewrong base sequence.
A: Proteins are the building blocks of the body. It plays an essential role in the body. Proteins are…
Q: Which best describes the storage of the genetic code? A gene is a segment of DNA, a condensed DNA…
A: Introduction: The mRNA that is present in the cell gets decoded when its nucleotides are read in a…
Q: differentiates the DNA from RNA.
A: DNA: It stand for deoxyribonucleic acid, which is a molecule that contains the instructions an…
Q: DNA _______________ adds an RNA primer that is complement to the template strand of DNA
A: DNA replication is the process in which DNA copies are made. it semiconservative, meaning that each…
Q: Which description best fits the definition of a messenger RNA? a An RNA that encodes for a protein b…
A: RNA is a single-stranded nucleic acid that aids in protein synthesis in our bodies.
Q: Describe the structure of DNA and explain how the structure of DNA supports the function of DNA
A: DNA is a long polymer of deoxyribonucleotides. The length of a DNA is defined as the number of…
Q: nfer what the result would be if the A site on the ribosome was not in the correct conformation…
A: The biochemical substance that is carried from the preceding generation to the succeeding generation…
Q: DNA ________ Depends on Differences in Length of Simple-Sequence DNAs.
A: Answer: Introduction: In a species, the nucleotide sequences of the repeat units containing…
Q: Refer to the figure to answer these questions:a. Add labels for mRNA (including the 5′ and 3′ ends)…
A: The central dogma in both prokaryotic and eukaryotic cell comprises of replication of parent…
Q: Describe the bonds that hold together the nucleotides in one DNA strand. Thencompare them with the…
A: Deoxyribonucleic acid (DNA) is a double-stranded molecule, which consists of two strands of…
Q: The name of the enzyme that cuts the DNA in order to remove a section of broken DNA is called
A: DNA stands for deoxyribonucleic acid which is the molecule that contains the genetic code of…
Q: Can substitute bases in DNA because of structural similarity.
A: A mutagen is a physical or chemical agent that permanently alters genetic material, usually DNA, in…
Q: DNA replication results in the creation of _____________ identical strands of DNA.
A: The consequence of DNA replication is two DNA molecules comprising of one new and one old chain of…
Q: are changes to the nucleotides in a segment of dna that codes for a protein.
A: Gene mutations are changes to the nucleotides in a segment of dna that codes for a protein.
Q: Use the codon table shown above to help answer this question. What protein sequence would a cell…
A: The mRNA sequence is: 5' CCAUGCACCAAUAGAUAACCG 3' The Codon is read in triplet form.
Q: TACAGAGATAACCGAATT A. Write the corresponding strand that would form the other half of the DNA…
A: Phosphodiester linkages connect DNA strands, which are polymers or chains of deoxynucleoside…
Q: Describe how nucleotides are connected to a growing DNA strand.
A: Deoxyribonucleic acid (DNA) replication is the biological process of producing two identical…
Q: When DNA is read by RNA synthase, mRNA is made. What is the name of the enzyme that reads DNA and…
A: DNA (deoxyribonucleic acid) is the genetic material of all the organisms on the planet except a few…
Q: a. Use the parent strand as a template to synthesize mRNA strand. Describe how the mRNA strand is…
A: Gene expression refers to the process that involves the formation of a functional product of a…
Q: Compare and contrast DNA replication, transcription, and translation
A: Replication transcription and translation involves the synthesis of DNA RNA and proteins. These are…
Q: _____________ are the linear sequences of nucleotides in an organism’s genetic information.
A: Cell possess genetic information inside the nucleus in the form of DNA as well as RNA, which act as…
Q: Use the chart to determine the correct amino acid that this DNA would 1 point code for - ATA
A: Introduction:- In order to determine the gene sequence based off an mRNA template. We can simply…
Q: Synthesize mRNA strands from the DNA templates
A: The DNA consists of two strand template strand and complementary strand. The molecule of DNA…
Q: In which direction, the new strand of DNA synthesised during DNA replication.
A: DNA is the information hub of the cell that contains instructions regarding protein synthesis. It is…
Q: Which is the complementary strand of RNA?
A: RNA is the ribonucleic acid that plays various important functions in decoding, coding, gene…
Q: Write detailed comments on the purity of the DNA
A: DNA is a double-helical structure of polynucleotide chains. It contains all hereditary information…
Q: Compare and contrast the structure of DNA and RNA.
A: In all living organisms, nucleic acids help in the formation of the building blocks. These are the…
Q: What is the role of Nucleotides in DNA replication
A: In molecular biology, DNA replication is the biological process of producing two identical DNA…
Q: To determine: The base sequence of complementary strand if a DNA molecule has base sequence…
A: DNA was identified in the nucleus in the late 1860s by Friedrich Meischer, but its function was…
Q: mutat
A: Mutation- when a DNA gene is damaged or changed in such a way as to alter the genetic message…
Q: Which compound represents the basic unit of both a DNA molecule and a RNA molecule? I-0-I I-6-I…
A: Biomolecules are chemical substances produced by a cell to maintain its function. They vary in size,…
Q: Explain to a friend the characteristics a molecule must have to function as genetic material and…
A: Introduction The main genetic material in most organisms is DNA. The basic properties for any…
Q: DNA from one human cell if stretched out would be _______ meters long
A: DNA stands for Deoxyribonucleic acid is a molecule which is composed of two polynucleotide chains…
Q: Which pattern does the structures of dna follow in that its replication results in one parent…
A: The central dogma of molecular biology briefs that DNA has instructions to synthesise proteins which…
Q: In a DNA strand the nucleotides are linked togther by?
A: The DNA or Deoxyribonucleic acid represent a molecule which carries genetic instructions to produce…
Q: DNA polymerase knows what nucleotide add next because it reads the ______________ strand.
A: DNA can add nucleotide to the end of 3rd strane only.
Q: Construct an explanation based on evidence for how the structure of DNA determines the structure of…
A: Proteins are the functional as well as structural units of cells. They are responsible for many…
The structure of DNA revealed how information is stored in the base sequence along a DNA strand. But what information is stored and how is it expressed?
Step by step
Solved in 2 steps
- Create the RNA strand to be synthesized from the DNA double strand below and explain this synthesis, including the functions of the molecules responsible for synthesis. 5-ATCGCTTGTTCGGAA-3 3-TAGCGAACAAGCCTT-5How are nucleotides connected to each other in a single strand of DNA? A. The nitrogenous bases and acids link the separate nucleotides into a chain. B. The phosphate group of one nucleotide binds to the sugar on the next nucleotide. C. The hydroxy group of one nucleotide stabilizes the phosphate group of the adjacent nucleotide. D. The sugar of one nucleotide binds directly to the sugar of the adjacent nucleotide.What defines one end of a DNA molecule as the 5’ end? a. What defines the other end at the 3’ end? b. When two strands of DNA are paired together to form a functional molecule, what is interesting to note about their 5’ and 3’ ends?
- Which describes the role of primase during replication? It catalyzes the formation of phosphodiester bonds using NTPs as substrates. It coordinates synthesis of the leading strand and the lagging strand. It functions as a holoenzyme that polymerizes in the 3’→ 5’ direction. It uses an exonuclease activity to remove incorrect nucleotides.Which statement describes Linus Pauling's contribution to the understanding of DNA structure? a Having first discovered the spiral shape of proteins, Linus Pauling used x-ray technology to hypothesize that the DNA molecule consisted of two consistently spaced strands that formed a spiral shape. b Having originally studied proteins, Pauling proposed that DNA was a three-chained helix with a sugar-phosphate backbone at the center and bases sticking out from the backbone. c Linus Pauling conducted experiments to prove that DNA carried genetic information. d Linus Pauling studied DNA base pairing.Which pattern does the structures of dna follow in that its replication results in one parent molecule and one daughter molecule.
- In the process of DNA replication, there are four important enzymes. Construct a table, provide what the four enzymes are, and explain how they function in DNA replication.When two adjacent bases in the same strand of DNA dimerize (form a covalent bond between them), what happens to the DNA? a. the original strand of DNA now contains a new DNA sequence b. the original strand of DNA is prevented from opening during replication, so this section of DNA will not be replicated c. the original strand of DNA is methylated, which causes the bases to mismatch d. the original strand of DNA is kinked, which prevents DNA polymerase from working properly e. the original strand of DNA is unaffected, so no additional mutations ariseMake a list of all components necessary for DNA replication; now explain how these components are used.
- What is the role of Nucleotides in DNA replicationWhich dna strand will be synthesized continuously during dna replication? a.The strand that is synthesized as Okazki Fragments b.the strand which is synthesized in the opposite direction compared to the direction of DNA unwinding? c.the strand which is sythesized in the same direction as the same direction of DNA unwinding? d.The m-RNA like strand e. The non-template strandWhat feature of a DNA fragment causes it to move through a gel during electrophoresis? a. the electrical charges of its phosphate groups b. its nucleotide sequence c. the hydrogen bonds between its base pairs d. its double helix shape