During translation, the ribosome follows along the mRNA template in the reaches a at which point a protein called and translation ends. 05' to 3': stop codon ; elF2 3' to 5': start codon; release factor 05' to 3¹: anticodon ; elF4 None of the above. direction, until it binds instead of a tRNA molecule,

During translation, the ribosome follows along the mRNA template in the reaches a at which point a protein called and translation ends. 05' to 3': stop codon ; elF2 3' to 5': start codon; release factor 05' to 3¹: anticodon ; elF4 None of the above. direction, until it binds instead of a tRNA molecule,

Name: During translation, the ribosome follows along the mRNA template in t
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: During translation, the ribosome follows along the mRNA template in thereaches aat which point a protein calledand translation ends.5' to 3': stop codon ; elF23¹ to 5': start codon ; release factor5' to 3¹: anticodon ; elF4None of the above.directio

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).
Identify the features of tRNA that are important in decoding genetic information and converting it into protein language.
Briefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNA
The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA (b) codons; DNA (c) anticodons; mRNA (d) codons; mRNA (e) codons and anticodons; rRNA
Portions of eukaryotic mRNA sequence that are removed during RNA processing are . a. exons b. caps c. poly-A tails d. introns
An mRNA has the following sequence: 5' ACCAUGUACUGUCCUGCUGUUUGA 3'. Beginning from the start codon, what is the third amino acid of the translated polypeptide?
Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into mRNA, and then translate it into the polypeptide. Give the polypeptide sequence in the following form: Met-Thr-Trp-Tyr-Val etc. 3' TCACAATACAAAGGTGTACTGATCTCATCTCCATAA 5'
What is the tRNA strand for the following mRNA strand: CAGGAUGAAUUGCUC
Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into mRNA and then translate it into the polypeptide. Give the polypeptide sequence in the following form: Met-Thr-Trp-Tyr-Val etc. 5' ACCGAAGGACTTATGGAGCGCTCATGATTTGCT 3'
During translation, the mRNA template is read and amino acids corresponding to the codons are linked together. Use the labels on the left to identify the components of the image that are involved in translation. the growing polypeptide chain that becomes the new protein the mRNA transcript an uncharged tRNA that has been released from the E site a charged tRNA, carrying an amino acid the P site holds a tRNA with its amino acid bonded to the polypeptide chain the A site into which the charged tRNA will bind the ribosome ACC 44 GGGU a charged tRNA, carrying an amino acid AUG UAA
A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a methionine amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site Lysine Asparagine Threonine Glutamic Acid