Answer multiple choice question in photo. Just a one sentence explanation is good F4$Which of the following statements is correct based on the above phylogeny?4RO Crickets are equally related to beetles and cockroachesO Crickets are equally related to dragonflies and antsO Crickets are more closely related to moths than beetlesO Crickets are equally related to ants and flies8F5%5▬TF6[A6DragonfliesCricketsCockroachesF7AntsBeetlesMothsYFlies&78DELLF8U* 008CF9prt sc(9F10home- OF11endF1211Pinsert

A tool for displaying the evolutionary relationship is a phylogenetic tree. The premise of the…

[ Dragonflies Crickets Cockroaches Ants Beetles Moths Flies Which of the following statements is correct based on the above phylogeny? O Crickets are equally related to beetles and cockroaches Crickets are equally related to dragonflies and ants Crickets are more closely related to moths than beetles O Crickets are equally related to ants and flies

[ Dragonflies Crickets Cockroaches Ants Beetles Moths Flies Which of the following statements is correct based on the above phylogeny? O Crickets are equally related to beetles and cockroaches Crickets are equally related to dragonflies and ants Crickets are more closely related to moths than beetles O Crickets are equally related to ants and flies

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter18: Organizing Information About Species

Section: Chapter Questions

Problem 10SQ

See similar textbooks

Similar questions

es ne Based on the information in the following table, and the given phylogenetic tree, what kind of species classification is shown? A B C D E F G H I J K L M N O Form of Male Genitalia 1 1 L L L L L L L L L L L L L Pits (P) or Tubercles (T) P P T T T T T P P P P P P P P Form of dorsal ridges M₁ M₁ M₂ M₂ M₂ M₂ M₂ M3 M3 M3 M3 M3 M4 M3 M3
Activity 3. Understanding the Cladogram Direction: Examine the illustration below and answer the questions thereafter. Fixt Amphibiats Reptites Dirds Rodentu Primles Fou shells FHair / fur Arriruote agg Four lintas Vorlebrao Eskaryntes Fig. 1. A cladogram of some familiar animals. Retnieved from https://ib.bioninja.com.au/standand-level/topic-5-evolution-and-biodi/54-cladistics/cladograms.html Activity Questions: 1. What characteristics do primates and rodents have in common? 2. Which Rodents? of animals are birds more closely related to? Reptiles or group 3. What do amphibians, reptiles, birds, rodents, and primates have in common? 4. What characteristic is unique only to birds and reptiles? 5. Fish and primates have a common ancestor. What characteristic does this ancestor have?
cture.com/courses/2070 B rces F2 0 - F3 0 + Question 5 O True Nonhuman primates tend to have the same types of teeth that humans have. O False Question 6 Apes belong to the taxonomic suborder O Primates F4 100 O Haplorhini Strepsirhini O Anthropoidea O Prosimii Ⓡ F5 Search F6 F7 ça F8 F9 2 pts BB 2 pts F10 O Fll
Based on the information from the following table and the provided phylogenetic tree, what kind of species classification is shown? A B C D E F G H 1 J K L M N O Form of Male Genitalia 1 1 L L L L L L L L L L L L L r T Pits) or Tubercles E P P T T T T T P P P P P Р P P O Phenetic Species Concept O Blological Species Concept O Phylogenetic Species Concept O Sympatric Species Concept Blayple (OUTGROUP) beaver Dan, AZ -Twentynine Paime, CA -Harkavilla, UT D-Chilchinbio, NM -Vermilion Cas. AZ 64 -F-Mone Lake, CA -G-Coral Pink Danes, UT H-Pyramid Lake, N -Crescent Dunes, MV Meno Lake CA -K-Olancha CA -Olancha, CA --Winnemucca, NV -El Mirage, CA Lo-Dumont Dunes, CA Form of dorsal ridges M₁ M₁ FFFFFFFFFF M Ma M₂ M₂
Megan, a paleontologist, is working with a new fossil collection of trilobites from the paleozoic era. Part of her research is figuring out how many species of trilobites are in this new collection. What species concept will Megan not be able to use while doing her work? Biological species concept O Phylogenetic species concept O Megan will be able to use all of them Morphological species concept O Megan will not be able to use any of them
PAUL-Copy of Copy of Evolution wert Format Slide Arrange Tools Extensions Help 4. ! 1 30¹ Q A Fit 1 option N 2 suspectum 淋 Click to add speaker notes An example of a cladogram of heloderms (Gila Monsters): W S 3 Source: Wikimedia, Kladoramm heloderma by MonsterDoc X H command 80 F3 horridum E $ 4 a R I D C F % 5 exasperatum F5 Arial Y V T G A 6 MacBook Air alvarezi Y B -22 & 7 H 40 F7 + U N charlesbogerti B I U A 0 8 Lines represent shared traits. 4. Suggest a shared trait for the line indicated: J DII * 1 Numbers represent common ancestors of the subspecies. M ( 9 K DD F9 O ) O : i Y F11 + C 1 option ? 44 . 1 Share J. H + e ? delete ret
Hello, I need help answering number 8 a, b, & c using the phylogeny below. Pls & thank you! 8. a) As you know, the largest mass extinction in the history of life on earth was the Permian extinction that occurred about 252 million years ago. The therapsids are often described as “mammal-like reptiles”. If the Permian extinction had caused the extinction of the therapsids, would mammals as we know them now have evolved? Why or why not? 8. b) Many lines of evidence, including biochemical evidence, show that living birds are direct descendants of dinosaurs. A number of dinosaur lineages had feathered dinosaurs, not just the lineage that includes living birds. Do you think that is it justified to believe that all feathered dinosaurs had behaviors known from living birds? Such behaviors of birds include colonial nesting, sexual displays by males using feathers, males moving to display their ornamental feathers to female mates. Give a brief reason for your answer. 8. c) A…
Life Sciences/P2 3.3 3.4 3.5 Describe the process of speciation through geographic isolation. The diagram below represents the evolution of the family Hominidae. 3.4.1 3.4.2 3.4.3 3.4.4 P Copyright reserved 14 SC/NSC Q R S Orang-utan 163 Gorilla Bonobo Chimpanzee Humani DBE/2023 Name the type of diagram represented above. Give the LETTER of the organism which: (a) Is the common ancestor of all hominids. (b) Shares the most recent common ancestor with the gorilla Name TWO organisms that: (a) Have S as a common ancestor (b) Are quadrupedal Describe THREE anatomical features of the skeleton of a quadrupedal hominid. Fossil evidence is used to support the 'Out-of-Africa' hypothesis. 3.5.1 State the 'Out-of-Africa' hypothesis. 3.5.2 Describe how fossil evidence is used to support the 'Out-of-Africa' hypothesis. TOTAL SECTION B: GRAND TOTAL:
Tree 1 Tree 2 Tree 3 outgroup В C outgroup В outgroup A В We have gathered some morphological data on three species of mythical mammals and the outgroup; these data are presented in the table below. Species Number of toes Eye color Tail Number of molars Outgroup 4 Brown Present 12 A Blue Absent 10 B Blue Present 12 C 5 Blue Absent 10 Now our task is to discover which of the three trees above is the most parsimonious, representing the most likely pathway of evolution. We determine the best tree by fitting the data in the table to each tree and calculating the number of evolutionary changes that are required. To facilitate our calculations, we will use the table below. The numbers in the table indicate the number of evolutionary changes that are required for each character in each tree.
A dolphin has the following classification, in order from most specific to most general.: Truncatus Tursiops Delphinidae Odontoceti Cetacea Chordata Animalia The species name is [Select] does the dolphin belong to? [Select] the family name of the dolphin? [Select] dolphin belongs to the order [Select] Which kingdom ✓ What is fg ✓ The 144 f10
of this =rab or ditions ionary escen- se or 5. Describe two examples of vestigial structures that you can find among the Caminalcules. These are structures that have been reduced to the point that they are virtually useless. Ear muscles and the tail bones are examples of vestigial structures in our own species. Explain how vestigial structures provide clues about a species' evolutionary past. Illustrate your argument with vestigial structures found in humans or other real species.
Please help to creating parsimonious treesFor the following DNA sequences determine the most parsimonious phylogeny. Tree ASpecies 1 AATTGCGGGATATATCGCGGGGAAATTTACGACTSpecies 2 AATGTCGGGATATATCGCGGGGAAATTTACGACTSpecies 3 AATTGCGGGATATATCGCGGGGAAATTTACGACT Tree BSpecies 1 AATTGCGGGATATATCGCGGGGAAATTTACGACTSpecies 2 AACTGCGGCATATATCGCGGGGAAATTAACGACTSpecies 3 AAGTGCGCCATATATCGCCCGGATAATTTCGAGA Tree CSpecies 1 CCGTATGACCGGGTATAAATCGCGCCCGGGATCTGCSpecies 2 CCGTATGAGGGGGTATATATCGGGCGCGGGATCTGCSpecies 3 CCGTATGACCGGGTATAAATCGCGCCCGGGATCTGCSpecies 4 CCGTATGAGGGGGTATATATCGGGCGCGGGATCTGC Tree DSpecies 1 GGGATATAGCGCACGATATCGTAGCCTAACGTTTTACGSpecies 2 GGGATATAGCGCACGATATCGTAAGCTAACGTTTTACGSpecies 3 AAAATATAGGCGTGGATATCGTAGCCTAACGTTGCATTSpecies 4 GGGATATACCGCACGTTATCGATCCCTAACGTTTTACG