doesn't need during vitro transcription dna template s dNTPs rns polymerase all none

Q: If there is harmful Mutation in Ligase, termination phase of DNA replication is effected True False

A: To understand the structure of nucleic acid, it is necessary to first understand the structure of…

Q: In recombinant DNA technology, restriction enzymes cleave the DNA at a specific site known as:

A: Restriction enzyme, also known as restriction endonuclease, is a bacterial protein that cleaves DNA…

Q: This is always the first step in the transcription process: O The two DNA strands are partly…

A: Transcription refers to the production of RNA from DNA. From the gene sequence of DNA, a…

Q: What is the role of the DNA Polymerase I 5' --> 3' exonuclease activity at a replication fork? O…

A: DNA polymerase I is an enzyme which has 3 functional activities which are : 5'-3' polymerase…

Q: --short fragment of DNA produced during replication of the lagging strand of DNA. * DNA polymerase…

A: DNA replication is the process by which new DNA is synthesized from old DNA template. DNA…

Q: You perform the following solid-phase oligonucleotide synthesis: DMT lodine, water, pyridine DMT-O…

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is…

A: Primer is short sequence which is complementary to the base sequence of DNA and is considered to be…

Q: In the following diagram of a replication fork, primers are shown as thick black lines and newly…

A: The heterocatalytic process by which a new DNA stand is synthesized on a old DNA template is known…

Q: OLD DNA NEW DNA mRNA PROTEIN STRAND STRAND NAME REPLICATION TRANSCRIPTION TRANSLATION CGT AGC TGC 1…

A: DNA ( Deoxyribonucleic acid) is a two stranded , helical structure present inside the nucleus of the…

Q: TFID controls translation O replication transcription O protein activity

A: as per the guidlines we are supposed to answer only first question, please repost the other question…

Q: Which of the following enzymes in E. coli synthesizes new DNA at sites of DNA damage during base…

A: The DNA repairing by the base excision repair and the nucleotide excision repair is done by the…

Q: . The table opposite shows the standard (coding strand) DNA inlet codes for the 20 amino acids…

A: Given , the  coding strand is     5'-CATCCAAATTGTTGCCCG-3' THE TEMPLATE STRAND WILL BE ,…

Q: | ampicillin resistance gene 5 restriction site 6 Origin of replication 7 Ligase 2 promoter 3 Xhol Ч…

A: Ans:-       Exon    is a region of DNA that is not transcribed. Restriction site is the location in…

Q: Describe two similarities and one difference between RNA polymerase and DNA polymerase Your answer…

A: RNA and DNA polymerase III  are used in synthesizing nucleic acids . DNA polymerase has proofreading…

Q: 5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ The template strand is shown. The +1…

A: DNA and RNA govern transcriptional activity or the mechanism by which a gene's information is used…

Q: What is Exons C

A: Exons are nucleotide sequences in DNA and RNA that are conserved in the creation of mature RNA.…

Q: The heterochromatin dissipates during Replication Recombination O Transcription None of the above

A: Transcription is a process of conversion of information in the DNA into RNA in the nucleus of the…

Q: What features of the bypass polymerase make it ideal for its role in translesion synthesis, shown in…

A: The process by which a cell detects and repairs damage to the DNA molecules that encode its genome…

Q: Some Events that May Occur during Transcription RNA polymerases detach. DNA polymerases detach. DNA…

A: DNA or Deoxy ribonucleic acid is the genetic material present in all living organisms. It contains…

Q: Do you think scientists working at Pitch Lake were at a great risk ofinfection from the organisms…

A: Pitch lake located on the Caribbean island of Trinidad and Tobago. It is a poisonous, toxic,…

Q: Telomeres enable DNA polymerase to synthesize new DNA at the tips of the 5' ends of eukaryotic DNA.…

A:

Q: Before the cell divides, 2 DNA strands must be available so that genetic information can be passed…

A: DNA replication is the process by which DNA makes a copy of itself during cell division.

Q: a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that…

A: DNA is the genetic material of almost all living organisms. It contains information that is…

Q: Telomeres enable DNA polymerase to synthesize new DNA at the tips of the 5' ends of eukaryotic DNA.…

A: Telomerase  Telomeric sequence on chromosomes is maintained by a special enzyme called telomerase.…

Q: Ac

A: The fundamental physical and functional unit of heredity is the gene. DNA is the material that makes…

Q: Which one is correct about telomeres? Choose at least one correct answer TTAGGG sequence is…

A: The distinctive structures that are found at the ends of our chromosomes and  consist of the…

Q: Don't use Ai

A: Conclusion:     The correct primer used in amplifying the required region of the DNA is 5' GAATGAC…

Q: Which process is illustrated in the diagram? NAA 5' Replication Transcription RNA processing…

A: Deoxyribonucleic acid, or DNA, is the genetic material found in humans and the majority of other…

Q: Some Events that May Occur during Transcription 1. RNA polymerases detach. 2. DNA polymerases…

A: Transcription is the process by which the information in a strand of DNA is copied into a new…

Q: DNA replication Transcription Polymerase moves along DNA template from 5' to 3' or 3' to 5? What is…

A: Central dogma, is  a process by which genetic information is being transferred from DNA to protein…

Q: "Builders" Initiation Termination Input/Starting Monomers Product/Final Signal Signals (think…

A: Replication, transcription and translation  all these processes occurs in 3 steps- initiation…

Q: What would happen in the directionality of that activity were reversed? Would proofreading work? If…

A: Despite the remarkable accuracy of DNA replication, errors can occasionally happen, such as when a…

Q: 8. Helps RNA polymerase recognize and bind the promoter. 9. Assemble the 30S, 50S ribosome, mRNA and…

A: The production of new DNA from the old DNA is known as replication. The production of RNA from DNA…

Q: . DNA polymerase requires both a template, to be copied, and a primer, which provides a 3' hydroxyl…

A: The process of DNA synthesis occurs in all of the living organisms and serves as a base for…

Q: DNA polymerase delta has Pril subunit that can generate RNA primers True false

A: DNA polymerase alpha is the eukaryotic polymerase associated with primase activity.

Q: Transcription V [Choose ] Coagulase RNA polymerase Translation DNA polymerse Ribosome Reverse…

A: The central dogma of molecular biology suggests the flow of genetic information from DNA to rna to…

Q: Part II. Transcription as a Process 4. Use the below "transcription bubble model" of a gene during…

A: Introduction:- Transcription is defined as the process of RNA ( coding as well as non-coding RNA)…