doesn't need during vitro transcription dna template s dNTPs rns polymerase all none

Q: 3c. there are three enzymes that go by the name of DNA polymerase 1 2 and 3. please describe the…

A: DNA polymerase helps in the synthesis of new strand of DNA. DNA polymerase is present in both…

Q: What is the role of the DNA Polymerase I 5' --> 3' exonuclease activity at a replication fork? O…

A: DNA polymerase I is an enzyme which has 3 functional activities which are : 5'-3' polymerase…

Q: --short fragment of DNA produced during replication of the lagging strand of DNA. * DNA polymerase…

A: DNA replication is the process by which new DNA is synthesized from old DNA template. DNA…

Q: You perform the following solid-phase oligonucleotide synthesis: DMT lodine, water, pyridine DMT-O…

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: OLD DNA NEW DNA mRNA PROTEIN STRAND STRAND NAME REPLICATION TRANSCRIPTION TRANSLATION CGT AGC TGC 1…

A: DNA ( Deoxyribonucleic acid) is a two stranded , helical structure present inside the nucleus of the…

Q: TFID controls translation O replication transcription O protein activity

A: as per the guidlines we are supposed to answer only first question, please repost the other question…

Q: Which of the following enzymes in E. coli synthesizes new DNA at sites of DNA damage during base…

A: The DNA repairing by the base excision repair and the nucleotide excision repair is done by the…

Q: . The table opposite shows the standard (coding strand) DNA inlet codes for the 20 amino acids…

A: Given , the  coding strand is     5'-CATCCAAATTGTTGCCCG-3' THE TEMPLATE STRAND WILL BE ,…

Q: hw shos the process of DNA replicaltlon impact mutations in an Individual? ALDNA eplication stops…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: 5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ The template strand is shown. The +1…

A: DNA and RNA govern transcriptional activity or the mechanism by which a gene's information is used…

Q: What is Exons C

A: Exons are nucleotide sequences in DNA and RNA that are conserved in the creation of mature RNA.…

Q: The heterochromatin dissipates during Replication Recombination O Transcription None of the above

A: Transcription is a process of conversion of information in the DNA into RNA in the nucleus of the…

Q: What features of the bypass polymerase make it ideal for its role in translesion synthesis, shown in…

A: The process by which a cell detects and repairs damage to the DNA molecules that encode its genome…

Q: 11. The template DNA for the beginning a gene is 3' – GATACATGAGGCGATACG – 5'. What mRNA transcript…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: Telomeres enable DNA polymerase to synthesize new DNA at the tips of the 5' ends of eukaryotic DNA.…

A:

Q: Before the cell divides, 2 DNA strands must be available so that genetic information can be passed…

A: DNA replication is the process by which DNA makes a copy of itself during cell division.

Q: Telomeres enable DNA polymerase to synthesize new DNA at the tips of the 5' ends of eukaryotic DNA.…

A: Telomerase  Telomeric sequence on chromosomes is maintained by a special enzyme called telomerase.…

Q: THCA 100 This reaction is Entropy is THC ( Leafly Mur AD RNA polymerase ATGACGOATCAGCCOCAAG…

A: Tetrahydrocannabinol Acid when heated converts into delta-9-tetrahydrocannabinol. the reaction is…

Q: Which process is illustrated in the diagram? NAA 5' Replication Transcription RNA processing…

A: Deoxyribonucleic acid, or DNA, is the genetic material found in humans and the majority of other…

Q: Which strand of DNA is used by RNA polymerase during transcription? O Coding strand O Lagging strand…

A: The process of transcribing a piece of DNA into RNA is known as transcription. Messenger RNA is made…

Q: I need help with a microbiology question from my study guide. The question involves DNA sequencing.…

A: mRNA sequence transcribed from the given template (antisense) is:   3'-A U G A C U G A C U G C U A G…

Q: Transcription is similar to DNA replication in that ... -RNA molecules are synthesized…

A: Transcription is the process by which information encoded in DNA is copied into RNA. It occurs in…

Q: will synthesize the in short pieces that are linked together by the enzyme , but the is made…

A: Deoxyribose nucleic acid (DNA) is the genetic material for almost all living organisms. DNA is a…

Q: "Builders" Initiation Termination Input/Starting Monomers Product/Final Signal Signals (think…

A: Replication, transcription and translation  all these processes occurs in 3 steps- initiation…

Q: 1. Describe the process of autophosphorlyation 2. Differentiate between chromosomes and genes. 3.…

A: Autophosphorylation is a process by which a protein kinase enzyme phosphorylates its own tyrosine or…

Q: SA4) Fill in the missing DNA, MRNA, anticodon and protein sequence. A codon table is available at…

A: DNA has two chains, having antiparallel polarity, 5’<--3’ in one and 3’-->5’ in other. One one…

Q: 8. Helps RNA polymerase recognize and bind the promoter. 9. Assemble the 30S, 50S ribosome, mRNA and…

A: The production of new DNA from the old DNA is known as replication. The production of RNA from DNA…

Q: . DNA polymerase requires both a template, to be copied, and a primer, which provides a 3' hydroxyl…

A: The process of DNA synthesis occurs in all of the living organisms and serves as a base for…

Q: DNA polymerase delta has Pril subunit that can generate RNA primers True false

A: DNA polymerase alpha is the eukaryotic polymerase associated with primase activity.

Q: Part II. Transcription as a Process 4. Use the below "transcription bubble model" of a gene during…

A: Introduction:- Transcription is defined as the process of RNA ( coding as well as non-coding RNA)…

Q: In the figure below, does A or B represent a site of DNA mylation? is ल 3' Edit CpG TA A G.CA V A…

A: DNA methylation is a heritable epigenetic mark in which DNA methyltransferases (DNMTs) covalently…

Q: Telomerase Nucleoside RNA Polymerase I RNA Polymerase II RNA Polymerase IIIon E of qu sven UOY…

A: As per the bartleby guidelines we are suppose to answer only first 3 questions for fill in the…

Q: Sensors detect the flash of light. DNA polymerase Unused deoxyribonucleotides are cleaved by…

A: DNA replication is the process by which new DNA is synthesized from old DNA within the nucleus of…

Q: The accuracy of transcription is less than the accuracy of DNA replication. The error rate of…

A: Replication is the process which is responsible for synthesis of DNA from the parental strand of…

Q: Which of the following is correct about transcription?    options:   The reaction is driven…

A: Transcription  It is the process of synthesis of pre mRNA from DNA.

Q: fAvery, MacLeod, and McCarty had determined that the transforming molecule was RNA, what…

A: In the history of DNA it is found that biologists were trying to identify the genetic material and…

Q: Template strand/Sense strand Coding strand/Antisense strand Region of DNA unwinding Region of DNA…

A: The sense strand, or template strand, is the only strand that is effectively employed as a template…

Q: coding strand A mutated sequence of DNA CA C GA AT TAGAT GG 5' 3, 5' C T AT GT G C T TA ATC TAC C…

A: Coding strand of DNA:- The DNA strand present in the direction of 5' to 3' acts as coding strand.…

Q: Wny does the "Tagging strand" of DNA heed to be replicated "discontinuously" In Okazaki ragments? O…

A: Okazaki fragments are some isolated and short DNA nucleotide sequences which formed in a…

Q: Some events that may occus during transcription 1. RNA polymerases detach 2. DNA polymerases…

A: Introduction DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: Which repair process(es) use(s) a DNA polymerase? Select all that apply. base excision repair…

A: DNA polymerases are the enzyme required for the synthesis and replication of DNA. There are…

Q: 1. (a)  RNA polymerase synthesis in a 5 -3 direction     Gene is switched ON     Gene is switched…

A: RNA synthesis and DNA synthesis both takes place in 5' to 3' direction. But these two synthesis has…

Q: *Replication bubble and position of O. fragments. restriction enzyme rho-dependent termination

A: Asp per the guideline we are allowed to answer only starting 3. Please repost the rest.

Q: Factions in our cells happen in a perfect way , therefore DNA replication is error free

A: DNA replication is defined as the process in which a double stranded DNA molecule is duplicated to…