Dnmt3 codes for a methyltransferase reproduction. If there is no inhibition, Dnmt3 into honeybee larvae? a male drone or a female worker female queen a male drone a female worker or a queen a female worker in bees. Worker bees are the result of inhibition of expression of genes related to size and a queen develops. Males result from haploid eggs. What do you expect would develop if you injected
Q: The significance that CAR T- cell therapy have on patience with tumours
A: CAR T-cell therapy is a form of immunotherapy that has been used to treat patients with certain…
Q: 5- crossover misalignment. B-Causes a duplication of a certain portion of chromosome while the other…
A: Introduction:- Evolution is defined as the descent with modifications. Evolution of life forms is…
Q: A new screening program was instituted in a certain country. The program used a screening test that…
A: The incidence rate is the proportion of total cases to total population exposure to disease. The…
Q: Mention and describe the two types of bacterial resistance to antibiotics. And which of the…
A: Antimicrobial resistance mechanisms can be divided into four main types: (1) decreasing drug uptake;…
Q: LO69 Identify whether a trait is epigenetic or genetic given an example. Determine if the following…
A: The study of stable phenotypic changes without changes to the DNA sequence is known as epigenetics.…
Q: macronutrients O Fe P C N
A: There are two basic types of nutrients to think about: macronutrients and micronutrients. The body…
Q: Some Soft-bodied insects, such as most larvae, have body contents that form a (a) skeletal system…
A: In this question it is asked that, what kind of body part is formed from body contents in soft…
Q: ↓ nutrients, ↑ metabolic waste, overcrowding - culture becomes sterile - accelerated binary fission…
A: Unicellular organism such as bacteria reproduce asexually through binary fission. It is a process…
Q: The following data indicates the percentage of time an average animal cell spends in each part of…
A: A cell cycle is defined as a series of events which takes place in a cell as it grows and divides. A…
Q: Explain the technologies and methods used for food production by modern society.
A: Since the inception of farming nothing much had changed before the Green Revolution. It was the…
Q: True or False: Cations and anions both easily cross the filtration membrane in a nephron 2. What…
A: Nephron is present in the Kidneys and is the smallest unit of filtration. It consists of renal…
Q: is located dorsal Which insect organ to the alimentary canal?
A: In case of insects, haemolymph is dynamic and not static, which means it is on either side of the…
Q: All of the following are true statements about epithelial tissue except Multiple Choice о O о O O…
A: Introduction : In animals and plants, the cells are grouped together to form tissues. A group of…
Q: Match the birth control method to its associated method of preventing fertilization and its…
A: Introduction The pituitary gland is categorized as an endocrine gland. It is an oval and…
Q: 1a. The top of Denali, Alaska (Mt. McKinley), is 20,322 feet above sea level and the total…
A:
Q: Describe the similarities and differences between mitosis and meiosis. Discuss at least two…
A: INTRODUCTION Mitosis : Also called equational division. Meiosis : Also called reduction division
Q: 12. Ashley DONLO Can you curl your tongue? Tongue-curling in humans (T) is a dominant genetic trait.…
A: Genetics is the study of gemes and heredity of how certain characteristics or qualities are passed…
Q: In a population of 300 humans, the following blood type frequencies for the MN blood group are…
A: Blood group of an individual is determined by presence/absence of antigen on RBC 's surface and…
Q: The population in class A was 20. In class A, three people became ill in June. Of them, two…
A: There are two key tenets that form the foundation of epidemiology. According to the first…
Q: Fatty acids are catabolized by a process called beta-oxidation. One of the products of beta-…
A: Cellular respiration is a series of metabolic reactions that occur within cells to convert…
Q: In paragraph how can a community sustain environment?
A: Environmental sustainability is connected with the careful or attentive use of the resources which…
Q: which of the following is NOT a step in rod phototransduction by rhodopsin? activation of rhodopsin…
A: In rod phototransduction a cascade of signalling involves G protein, transducin, and…
Q: A study team investigated stomatal density of different species of leaves. The data they collected…
A: Eurasian Watermilfoil is a submerged aquatic plant that thrives in stagnant or slowly moving water…
Q: Cranial and post cranial primary characteristics of archival Homo include____. a. Large browridges…
A: Introduction Archaic Homo sapiens or early Homo sapiens evolved much earlier than modern man. Brain…
Q: LO65 Compare methods that Covid tests and Covid vaccines use.
A: Comparison of methods that Covid tests and Covid vaccines use. there are several test method used…
Q: Compare and contrast the senses of taste and smell by dragging the choices below into one or both of…
A:
Q: 6. Most of the water and solutes is absorbed in the large intestine 7. Antibodies are produced from…
A: Large intestine are responsible for majority of water and solute absorption, whereas small…
Q: Which of the following statements is most directly described by the first law of thermodynamics? A B…
A: First law of thermodynamics is a kind of energy conservation law which states that energy can…
Q: How can the knowledge that we gained from the Zika and Ebola outbreaks be applied to this current…
A: There has been multiple pandemics in the last century. These pandemics has frequently been examined…
Q: Fungi can reproduce through are the result of mitosis of differentiated haploid mycelia. asexual…
A: Introduction Any member of the eukaryotic group of organisms, which also includes yeasts, molds,…
Q: Lipid solubility is an important parameter that determines the predicted effectiveness of new…
A: Drugs move from a high-concentration area to a low-concentration area across a cell membrane. The…
Q: What are the advantages and disadvantages of performing manual CBC?
A: Advantantages of manual CBC. The main advantage is that a trained observer can detect minute…
Q: If in an offspring there is a "zigzag" segregation for the [y] mutant phenotype (recessive mutation)…
A: Zigzag segregation is a phenomenon in which genetic material is passed on in an irregular or zigzag…
Q: Not all animals have organ systems or even organs. What are the advantages to having specific…
A: the animal doesn't contains organ and organ systems are knows as unicellular organism. it contains…
Q: If deoxyribonucleotides that lack the 3’-OH groups are added during the replication process, what do…
A: DNA replication is a process in which a double stranded DNA will be copied to produce two identical…
Q: transcription initiation site GCAGTGACCGGATATAACGAAGAGGAATGCCGTACAAA 5' UCCUUAC 3' Which of the…
A: Coding strand is the that strand of DNA whose sequence is identical to the mRNA sequence while…
Q: Which molecular processes are involved in Covid tests that use PCR? Gene expression Transcription…
A: Introduction The polymerase chain reaction ( PCR) is also called "molecular photocopying" and is a…
Q: The chemical communication in animal nervous systems involve: O Electrical charges traveling within…
A: There are mainly two types of communication in animal nervous system: Electrical communication…
Q: Draw and label the parts of the growth curve
A: Bacteria are prokaryotic, unicellular organisms and they reproduce by binary fission. During binary…
Q: 220. A randomized clinical trial is conducted to assess the efficacy of a new smoking cessation…
A: The ratio of successful cessation to unsuccessful cessation to the total is 2:3:5. So we come to…
Q: G-LO37 Identify the consequences of mutations in different regions of a gene. The image below…
A: A mutation is a change to an organism's DNA sequence. Errors in DNA replication during cell…
Q: LO 78- Explain how organismal phenotypes can be influenced by more than one gene. Select the…
A: Phenotype is the simple expression of genotype. But it may be controlled by one or more than one…
Q: There two questions that will be asked interview for applying to be in the lab field. What are your…
A: My strengths are ---- Im completed my degree with a very good performance and i'm a skilled…
Q: To get approved by the FDA generic drugs have to demonstrate the following: That their bio…
A: Generic medications are copies of brand-name medications created by another company that is produced…
Q: Pain, especially intense sensations, is unpleasant and sometimes difficult for a person to cope…
A: Pain is a personal, subjective experience with sensory, affective, and cognitive components. The…
Q: A farmer decides to plant Xmas trees. She estimates each one will sell for $75. -How much will the…
A: Given that the farmer wants to plant Xmas trees on 10 acres of land. If she can grow 50 Xmas trees…
Q: The DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using…
A: DNA is a double helical structure with two DNA strands. One strand serves as a template for the…
Q: Ras/MAP kinase signal transduction cascade
A: MAPK signaling pathway: It is also known as the Ras-Raf-MEK-ERK pathway. It is a chain of proteins…
Step by step
Solved in 2 steps
- 5). Female honeybees at birth have equal potential to develop as workers or queens. Queens are much larger than workers, have functional ovaries, and reproduce constantly. Workers don't reproduce and spend their lives collecting food, tending the queen, and raising her offspring. Certain female bees become queens due to consumption of royal jelly, which silences the expression of a gene encoding a DNA methyltransferase, Dnmt3 (this means that it's function is to add methyl groups to DNA). Thus, queen vs. worker bee fate is regulated epigenetically. a. Is Dnmt3 an epigenetic writer or eraser enzyme? b. Do you predict that Dnmt3 target genes are expressed at higher levels in queens or workers? c. How would you expect bees to develop (as queens or workers?) if they lack NP95 function (i.e. are homozygous for a loss of function mutation in the bee ortholog of NP95, involved in maintenance of DNA methylation)? Include a description of the impact of royal jelly consumption and your…Analysis of Hunchback mRNA expression tells us what about Hunchback gene expression? That the Hunchback gene is always on That the Hunchback gene is not expressed in the fruit fly That the Hunchback gene is turned on and off during development NothingWhich of the following statements about sex determination in Drosophila is false? Males transcribe sex-lethal, females do not. The X/A ratio controls the transcription of sex-lethal. Double-sex RNA is spliced differently in males and females. Transformer regulates the splicing of double-sex RNA. Functional transformer protein is only produced in females.
- A Drosophila egg that is bed lbcd may develop normally, but the adult fruit fly will not be able to produce viable offspring. How is this possible? The mother can provide the bcd mRNA required for normal development, but the adult bcd /bcd female fly cannot make its own bcd mRNA. The Hox genes in the egg play a redundant role to bcd during development in a bcd / bcd egg, but reproduction requires bcd. Drosophila sperm contains the functional bcd gene product required for normal development, but the adult sex cells will not be able to produce the functional product. The nanos gene product functionally compensates for lack of bcd expression in the developing fly but not in its offspring.Explain what a morphogen is, and describe how it exerts its effects. What do you expect will happen when a morphogen is expressed in the wrong place in an embryo? List five examples of morphogens that function in Drosophila.The early Drosophila embryo is a syncytium. Why is this significant? O a. it allows the segment polarity proteins, Wingless and Hedgehog, to function as morphogens to establish the segmental boundaries O b. it allows the establishment of transcription factor gradients, which provide positional information O c. it eliminates the need for localized cytoplasmic determinants O d. all of the above
- The following diagram illustrates four genes from the genome of a certain insect. Different binding sites are labeled in the enhancer region of each gene. enhancer promoter ABC D E Gene 1 A D Gene 2 АС DE Gene 3 ABD Gene 4 In order for a specific gene to be expressed in the insect's cells, all of the gene's binding sites must be bound by transcriptional activators. • The insect's brain cells contain activators that bind to sites A, C, D, and E • The insect's salivary gland cells contain activators that bind to sites A, B, and D Which of the following is the most likely pattern of gene expression for the insect described above? Gene 2 will be expressed in both brain and salivary gland cells Both gene 1 and gene 4 will be expressed in salivary glands, but neither will be expressed in brain cells Gene 1 will be expressed in both brain and salivary glands Both gene 2 and gene 3 will be expressed in brain cells, but neither will be expressed in salivary gland cellsDraw a diagram to illustrate how a concentration gradient of a transcription factor along the anterior-posterior axis of a Drosophila embryo can create a region in the middle in which transcription of a target gene takes place without being transcribed in either the anterior or posterior region.describe the arrangment of Hox genes on each chromosome in mammals in relation to their expression pattern. What effect would you expect if you expressed a Hox gene more anterior to its normal expression domain?
- You have identified a Drosophila gene that is expressed exclusively in the odd-numbered "stripes" in the cellular blastoderm. Assuming that this gene is not redundant, what would be the most likely phenotype cause by a loss-of-function mutation in this gene? an embryo missing odd numbered segments an adult fly with a second pair of wings instead of halteres an embryo with two anterior ends an embryo missing even-numbered segments an embryo missing larval segments 3-10There is a gene in the fruit fly (Drosophila) called antennepedia. It controls the formation of which structures? What happens when it isIn flies developing from eggs laid by a nanos−mother, development of the abdomen is inhibited.Flies developing from eggs that have no maternallysupplied hunchback mRNA are normal. Flies developing from eggs laid by a nanos− mother that alsohave no maternally supplied hunchback mRNA arenormal. If too much Hunchback protein accumulatesin the posterior of the egg, abdominal developmentis prevented.a. What do these findings say about the function ofthe Nanos protein and of the hunchback maternallysupplied mRNA?b. What do these findings say about the efficiency ofbiological processes that are subject to evolution?