DNA Template Parental DNA New DNA THINK THIS OVER: 1. How can you relate this experiment in replicating your own DNA? 2. What can you say about the limitations of this model?

Can someone explain this?

7. How could genetic engineering be of use to humans? Describe at least 2 different uses.8. What was the genetic marker used in this experiment? Be specific.9. What enzyme helps to “glue” the donor DNA and plasmid together to form recombinant DNA?

4

4. What is the name of the process by which bacteria pick up a different organism’s geneticmaterial?5. Genetically, how does the original bacterial DNA (plasmid) differ from the final bacterial DNAmolecule? (Do not say, “It is longer.”)6. Tetracycline is an antibiotic that is prescribed to kill bacterial infections. The transformedbacterial cell that you created has the tetracycline resistant gene in it. If this cell is placed on agrowth medium with tetracycline, will the bacteria grow or die? Explain.

2. Dr. Kim at Ewha Research Center performed shotgun Sanger sequencing on an unknown DNA sample, and obtained the following reads (12 reads). Since the length of each read is quite short, Dr. Kim ran the original sample in a gel electrophoresis, and realized that the original DNA is just 50 base pairs long. (Please note that the resolution of gel electrophoresis is not so good. Thus, we cannot figure out the exact length of DNA using gel electrophoresis in the real world.) 1) САСТС ССAGT GTACC T 3) GGAGT CAАТC GC 5) GGCTG TGCTT GG 7) GATGG CTGTG 9) CAGTG TAССT GCA 11) TGCAA GCCGA G 2) AGCCG AGATG GCTG 4) CTGCA AGCCG A 6) CTTGG AGTCA ATCGC 8) САСТС ССAG 10) GCTGT GСТTG G 12) TGCTT GGAGT (a) Find the sequence of the original DNA (reconstruction), and align each read with the reconstructed DNA sequence. (hint: put all reads on a ppt slide, and move them around to find overlaps.) (b) Calculate coverage at each nucleotide position of the reconstructed DNA, i.e., how many reads cover that…

3. Look at the sequences below. If you add a restriction enzyme(that cuts at GAATTC) to the uncut DNA, how many DNA fragments will result? Circle the fragments. Uncut DNA 1: TGATCGTGGAATTCGATGATCGAATTCGCTAGCTGAATTCAAAAAA ACTAGCACCTTAAGCTACTAGCTTAAGCGATCGACTTAAGTTTTTT Number of fragments: Uncut DNA 2: Number of fragments: Length of fragments: TGATCGTGGACTTCGATGATCGAATTCGCTAGCTGAATTCAAAAAA ACTAGCACCTGAAGCTACTAGCTTAAGCGATCGACTTAAGTTTTTT Uncut DNA 3: basepairs (ignore ends with unpaired bases) Length of fragments: basepairs (ignore ends with unpaired bases) TGATCGTGGACTTCGATGATCGAATTCGCTAGCTGCATTCAAAAAA ACTAGCACCTGAAGCTACTAGCTTAAGCGATCGACGTAAGTTTTTT Number of fragments: Length of fragments: basepairs (ignore ends with unpaired bases) 4. You are given a new sample of DNA that matches one of the uncut samples above (1, 2, or 3). How could you use restriction enzyme analysis to match your unknown sample to one of the known samples (1, 2, or 3)? Explain below.

4. How is a randomized DNA library created?   MARK ALL THAT APPLY. the use of Mn2+ rather than Mg2+ by DNA Polymerase PCR with dideoxynucleotides Mutagenic PCR Lots of books Add more dNTPs than normal to a PCR reaction

5. Design a 10-bp primer that could be used to amplify the following sequence of DNA: 5'-AGTCGATCCCTGATCGTACGCTACGGTAACGT-3'

3