Q: Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’…
A: Transcription is the first stage of gene expression, in which a particular segment of DNA is copied…
Q: The regulation of the blood glucose level represents an important feedback loop in the hu- man body.…
A: The mechanism through which the body keeps blood glucose levels, particularly glucose…
Q: Describe the formation of chromosomes
A: Answer: Chromosomes : It is the long thread like structure of proteins and a single molecule of DNA…
Q: The mismatch repair (MMR) components work closely with the DNA replication machinery
A: The mismatch repair or MMR is a process by which DNA is repaired by removing the mismatched…
Q: According to Jonathan Drori, angiosperms evolved a "more intelligent" way of reproducing by…
A: Angiosperms are the largest groupof flowering plants on earth. and it is most diverse part of land…
Q: A man develops a scrotal skin abscess following vasectomy. Which of the following sets of lymph…
A: Lymph nodes are small, round or bean-shaped structures that are found throughout the body. They are…
Q: All of the following apply to Luria and Delbrűck’s mutation theory as tested using E. Coli and T1…
A: The answer is option c. All of the following apply to Luria and Delbrűck’s mutation theory as…
Q: Upon the experiment of the Analysis of Saliva, What possible precipitate can form in the test for…
A: Saliva is essentially a thick fluid present in our mouth. Since it softens the mouth and makes…
Q: Miles and Misra serial dilution strategy to determine bacterial density (cfu/ml) and if infection is…
A: Miles and Misra's method is also known as viable surface count. This method counts a number of…
Q: Which of the following is NOT TRUE about Eukaryotic Transcription: A. Occurs in the cytoplasm B. Pol…
A: Introduction Eukaryotic transcription is the complex process by which eukaryotic cells transcribe…
Q: Secondary contact only plays a role in some of the speciation modes. Name the mode(s) of speciation…
A: Species include organisms that can interbreed. This interbreeding between the members of the species…
Q: The____ tool industry characterizes the Middle Paleolithic / Middle Stone Age and spans the time…
A: Introduction Evolution is the process of gradual, heritable change in the characteristic of the…
Q: A human STR locus contains a tandem repeat (TAGA), where n may be any number between 5 and 15. How…
A: Introduction The traits of a living organism are determined by its genotype. These traits are…
Q: molecular motors
A: Molecular motor proteins: These are a class of molecular motors which move along the cytoplasm of…
Q: 18. Which of the following has not been a major cause of the global population explosion that began…
A: Introduction POPULATION:- Population is the number of people in an area or a place. Therefore,…
Q: What is production
A: Ecology The study of interactions between living things, such as humans, and their natural…
Q: The results of blood agar from the umbilical cord(a) and blood culture(b) both show beta haemolysis…
A: Microorganisms require nutrients for life, development, and reproduction, which are provided by…
Q: 4a) Which of the following is true about infants’ visual acuity? Select one: i. Poor visual…
A: Proper child development is very important in a person's life. From infancy until early adulthood,…
Q: Histological preparation of skin demonstrates dense unformed connective tissue. What layer of this…
A: Skin is composed majorly of Epidermis, Dermis ( papillary and Reticular), and Hypodermis. All these…
Q: How to produce CAR T cells effectively in bioreactor system while overcoming shear stress in…
A: Introduction:- Bioreactors are vessels or tanks in which whole cell- free enzymes transform raw…
Q: Please answer this question by drawing on the diagram with different colors and answer all the parts…
A: Meiosis is the cell division process that involves production of 4 haploid (n) daughter cells from a…
Q: Which variables are used when calculating the encephalization quotient? a. absolute brain size b.…
A: Encephalization quotient (EQ) is a relative brain size measure that is defined as the ratio between…
Q: Assuming that the mean size of the human sau3AI partially digested fragments clones is 3kb,…
A: Human sau3AI is a tool used to help predict and diagnose disease. It is a blood test that looks for…
Q: Researchers have found that a certain signal transduction pathway, illustrated in the figure below,…
A: Signal transduction is the pathway in which there is a relay of the signal that takes place from a…
Q: Which of the following correctly describes mitosis? A It regulates the transfer of genetic…
A:
Q: etermine the responsiveness of the wild-type protein to maltose, the way by which mutation affects…
A: Prior to the reporter gene transformation, the lacZ - bacteria were mutagenized. The altered…
Q: What is the significance of having a properly collected urine What is the drawback of routine…
A: Question : What is the significance of having a properly collected urine. Answer : Proper…
Q: give answer asap please.
A: The heart defects which occur in an individual from birth are called congenital heart defects. These…
Q: What is precocene. 2. Different sources of precocene (plant and chemical). 3. Source of…
A: Precocene is members of Chromenes and an aromatic ether having chemical formula C12H13O2. it is a…
Q: The Multiregionalism model of modern human origins hypothesizes that____. a. some features of…
A: The evolution of humans is based on different hypotheses. There are two hypotheses which are more…
Q: C. Use of Antimicrobials - Disk Diffusion Method + Antibiotic used Ex. Amoxicillin E15 -…
A: An Antibiotic is a chemical substance used to inhibit bacterial growth or it is used to kill…
Q: 18 14 15 19 16 17 6 8 Figure 1 Nereis parapodium whole mount Figure 2 Nereis cross section.…
A: Nereis is a genus of the worm under the family Nereididae. Its the type of polychaete worm. They use…
Q: 1. Where in the testes are sperm cells produced? 2. Which cells produce male sex hormones? 3.…
A: The male reproductive system consists of the external genitals like penis,scrotum etc. and the…
Q: When making bread with common yeast, the reaction starts as an aerobic process and then becomes an…
A: The bubbles obtained in the bread is the result of the formation and collection of gases such as…
Q: All of the following are true about the design of the Beadle and Tatum experiment (one gene one…
A: The "one gene, one enzyme" theory was supported by George Beadle and Edward Tatum's demonstration…
Q: trp attenuation mechanism
A: Attenuation: It is a mechanism for reducing the expression of the trp operon when levels of…
Q: 72 Arthur Arthur may be fed up, but he's absolutely necessary. Explain why cells need Arthur and his…
A: Here the boss is the DNA strand from which arthur and his co worker carol are formed. arthur and his…
Q: glucose Glycoly sis (b). Glucose is split into two 3-carbon chains called AcetylCoEnzymeA in order…
A: Cellular respiration can be defined as a set of metabolic processes that occurs in the cells of…
Q: Which of the following is NOT involved in oxygen production in photosynthesis? Photosystem I O Light…
A: Introduction : Autotrophic plants produce their own food through a process called photosynthesis.…
Q: description of the growth and growth pattern of the microorganisms in the pour plate method?
A: What do you understand by the term pour plate method? Give a brief description of this method.. What…
Q: What kinds of legal issues do you think stem cell research and genetic therapies will present int he…
A: Nowadays stem cell research can offer some big opportunities to understand the basic mechanisms of…
Q: How can one remedy the effect of pH change due to sterilization?
A: Explanation : During the process of Sterilization, the components of the medium suffer chemical…
Q: Give the role of starch solution, phosphate buffer, and NaCI solution in the amylase test. What are…
A: The amylase test is a laboratory test used to measure the level of amylase in the blood. Amylase is…
Q: You create a premature stop codon as a result of an induced mutation in the lab. What type of…
A: Premature termination codons (PTCs) are the result of one-nucleotide changes that transform a…
Q: The following DNA sequence is found on a chromosome in rice plants: 5’…
A: Given DNA sequence: 5’ ACCTTGCTCACATGTGGCGTACCTTTCCGTCTATCTGAACAC 3’ Since, this is the…
Q: Describe one chemotherapeutic approach that can be used to treat prostate cancer? (Your answer…
A: Introduction:- Cancer is defined as the uncontrolled and unregulated proliferation of normal cells.…
Q: Hormones are chemical signaling molecules produced by specialized cells and transmitted via the…
A: A hormone is a class of signaling molecules found in multicellular creatures that are transmitted to…
Q: Which of the following describes training to strengthen the neck for tactical athletes? A necessity…
A: Athletes are people who take part in physical activity in order to compete in sporting events. There…
Q: Which of the following best describes a way in which a normal growth factor can stimulate cell…
A: A growth factor is a naturally occurring molecule that can promote cell growth, wound healing, and…
Discuss how the body uses/processes alcohol and state why alcohol is good or bad for an athlete in training.
Step by step
Solved in 3 steps with 1 images
- Discuss the short and long term dangers of alcohol. Discuss both dangers to the individual drinker and to other people.Briefly explain why some individuals cannot tolerate alcohol as well as others.Define drug dependence and explain the difference between physical dependence andpsychological dependence of drugs.
- Describe the short-term and potential long-term effects of alcohol on the bodyDescribe the effects of excessive alcohol use on the body.If you are on the road it is safest to avoid drunk drivers for your own safety as well as the safety of your passengers. List 3 signs of an impaired driver. Discuss the importance of driving and not drinking even one drink.
- Which six drugs are mostly used by young adults ages 18-25? Which six drugs are mostly used by all Americans ages 12 and older? Identify the most used and most abused drugs in American society. Analyze the reasons people drink alcohol. Describe the factors that affect one’s rate of alcohol absorption. Identify people most likely to suffer from the disease of alcoholism and describe the effects on their lives. Explain the process of recovery from alcoholism. Discuss binge drinking. List and discuss the various forms of tobacco products. Your answer Typed answers are easier for students to read than handwritten notesASAP QUICKLY What is alcohol use disorder? Mention the symptoms and treatment that can be given? Don't copy from GoogleWhich drug is contraindicated to clients with history of alcohol abuse? (exact answer please) Phenytoin Baclofen
