Deamination of adenine results in the formation of hypoxanthine. Hypoxanthine selectively base pairs with cytosine. If this error is not corrected, what base pair can the original A·T base pair be converted to after cycles of DNA replication?a) G·C b) C·G c) T·A d) A·G

Q: The BamH1 enzyme comes at a concentration of 100,000 U/ml. You are asked to digest 20 ug of DNA with…

A: The term "specific activity" describes the amount of an enzyme's enzymatic activity that is produced…

Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…

A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…

Q: Assume the following DNA template strand: 3'-ATA GCG AGG AGT ATC-5' A) What would be the protein…

A: Introduction  A mutation is a change in the structure of a gene, which is the fundamental unit of…

Q: DNA replication always proceeds in only one direction because the ________ of the incoming…

A: DNA replication is an important part of the cell cycle and it takes place in the S-phase of the cell…

Q: Answer the following questions. A) Write the protein that catalyzes the formation of phosphodiester…

A: Thousands of different enzymes catalyze metabolic processes in cells. Enzymes are proteins that…

Q: The pro Tien responsible for the initial step in unwinding the DNA helix during replication of the…

A: Answer is dnaA. The protein responsible for the initial step in unwinding the dna helix during…

Q: REPLICATION TRANSCRIPTION a) Origin of Replication a) Origin of Replication b) Promoter TRANSLATION…

A: For replication, origin of replication is important where replication machinery will form and start…

Q: Which of the following is false when considering repetitive DNA?   a) STRs are the same as…

A: Noncoding regions include introns that do not code for any amino acids or proteins. However, they…

Q: Which of the following equations are true for double-stranded DNA?  a) (%G+%T) =(%A+%C) b) (%G+%A)…

A: DNA stands for deoxyribonucleic acid. It is a genetic material that passes from one generation to…

Q: Telomeres are guanine-rich caps on the ends of each chromosome. Which of the following is the most…

A: Telomers are the non-coding repeated sequence present on the end of DNA in a chromosome. They are…

Q: Which of the following represents a missense mutation in the DNA coding strand sequence, 5' -…

A: A change in the structure of DNA, known as a mutation, can alter the sequence of amino acids that…

Q: A). Briefly describe the function of telomerase. B). How does the structure of telomerase allow it…

A: Hello! Since you have posted multiple questions, we are answering the first question only. Kindly…

Q: What would happen if, in the course of replication, the topoisomerases were unable to reattach the…

A: Replication is the process of copying the DNA molecule to form two daughter DNA strands before the…

Q: A temperature-sensitive mutation is one in which the defect is not presented functionally until the…

A: Introduction  Enzymes are the biomolecules especially proteins. Which helps in the speeding up of…

Q: b) For a DNA strand with the given genetic code of bases , undergoing transcription, what will be…

A: The central dogma of molecular biology is the synthesis of mRNA and polypeptide chain by…

Q: DNA strands that can form a double helix are said to be Select an answer and submit. For keyboard…

A: Deoxyribose Nucleic Acid or DNA is a double-stranded molecule with the shape of a twisted ladder.

Q: What would be the a.) Product of replication b.) Product bof transcription of the following fragment…

A: Deoxyribonucleic acid or DNA is a type of nucleic acid present in the nucleus of the cell. It is a…

Q: Chemical mutagens often cause oxidation or deamination of DNA bases. This can lead to cancer by…

A: DNA damage is often caused by external sources like radiation exposure, exogenous chemical reactions…

Q: Which is not a property of DNA polymerase? a) It requires a primer to begin synthesis b) It adds…

A: Note : As many questions have been asked, only the first multiple choice question (question number…

Q: The transposase enzyme is essential for transposition because

A: Answer:  Transposase is an enzyme which required for the transposition of elements of DNA.

Q: Direct repair of pyrimidine dimer formation in E. Coli can be accomplished by nucleotide excision.…

A: Escherichia coli, commonly abbreviated as E. coli, is a gram-negative, rod-shaped bacterium that is…

Q: Which of the following DNAs is most likely to contain the recognition sequence for a homodimeric DNA…

A: Ans - a.)  5’- G A G C G A T C G C T C - 3’                       3'- C  T C G C T A G C G A G -5'…

Q: DNA double helix is stabilized by ...   a)  H-bonds between the sugar-phosphate backbones.   b)…

A: Answer. Watson and Crick first describe the structure of DNA double helix in 1953 e using x-ray…

Q: b) For a DNA strand with the given genetic code of bases , undergoing transcription, what will be…

A: The central dogma of molecular biology is the synthesis of mRNA and polypeptide chain by…

Q: DNA-binding proteins interact predominantly within which portion of a double-stranded DNA helix? A)…

A: dna is the genetic material , which store all the biological informations.

Q: While there is a T nucleotide in one position in one of the double chains, if there is a G…

A: A mutation is a change in the DNA sequence, the genetic material of life. DNA is composed of four…

Q: 10) In the diagram below: a) Label a phosphodiester linkage b) Label an N-glycosidic bond c) Label…

A: Phosphodiester bond : This bond is formed by the condensation of sugar and phosphoric acid…

Q: Deamination of cytosine to form uracil can happen spontaneously during replication. It can be…

A: Deamination is a chemical process that removes an amino group from a molecule, such as a nucleotide…

Q: CG Islands in DNA are important for :-  A) Methylation  B) Acetylation  C) t- RNA synthesis  D)…

A: CG islands are also known as CpG islands in DNA  that play a vital role in gene expression .

Q: Insulin is synthesized as preproinsulin, which has 81 amino acids. How many heterocyclic bases must…

A: Insulin is synthesized from preproinsulin. The preprotein is then cleaved by a proteolytic enzyme to…

Q: All of the following are involved in DNA replication excepta) polysome.    b) gyrase.        c)…

A: DNA is the genetic and hereditary material in all living organisms. When a cell divides, DNA is…

Q: Explain how DNA polymerase and topoisomerase 2 contribute to replication in E.coli and what is the…

A: It is principally selected to replication-obstructing DNA sores (lesions) to combine the early…

Q: ARE THEY TRUE OR FALSE? a) In a caesium chloride density gradient centrifugation method performed…

A: DNA is the genetic material that helps to control all the activity of the cell. The replication,…

Q: Which of the following items do not affect the melting temperature of DNA? A length of the DNA B the…

A: Melting temperature ( Tm): half of DNA gets denatured (melts). Tm = 2* (A+T) + 4* (G+C)

Q: From which end of a strand of nucleic acid does DNA polymerase I REMOVE nucleotides? A) 5' B) 3'…

A: DNA polymerase 1 has three types of polymerase activity. 1. 5'-3' polymerase activity- It is…

Q: For double-stranded DNA, which of the following statements is true? a) A = C b) A = G and C = T c) A…

A: For double stranded DNA,  According to Chargaff's rules state that DNA from any species of any…

Q: How many unique primers are required to amplify a single DNA target region?   a) 1 b) 2 c) 4 d)…

A: Targeted sequencing is a fast and low-cost method to detect known and novel variants in specific…

Q: The activity of restriction enzymes may produce fragments with sticky ends.  Sticky ends are   a) a…

A: Correct option is (c). Restriction enzyme, also called as restrictions endonucleases,  is a…

Q: 3' Shown is a segment of DNA about to be replicated. a) What is the sequence of the complementary…

A: DNA replication is a biological process that occurs in all living organisms and is the basis for…

Q: A DNA polymerase enzyme inherently incorporates an incorrect nucleotide at a low but measurable…

A: The germ "mutation" is used to define any condition where there is any kind of alteration in the…

Q: Which of the following single stranded DNA oligonucleotides alone would be expected to spontaneously…

A: DNA is a double stranded structure in which each strands are made up of nucleotides. Nucleotide is…

Q: Recombinational repair is often due toa) Incorporation of many incorrect nucleotides by DNA polb)…

A: The damage to deoxyribonucleic acid is a common occurrence in all cells. Most of this damage is…