3. Consider the following diagrams representing three different DNA molecules. (a) 5' w 3' 3' 5' (b) 5' 3' 5' 3' (c) 3' 5' Assuming that DNA polymerase is the only enzyme present and that there is no additional DNA, state whether each of these molecules can serve as a substrate for DNA synthesis. Give reasons as to why or why not.

1. Consider the following DNA segment: 5’….ATGCCCGATCAGAGCTTT…3” 3’….TAGGGGCTAGTCTCGAAA…5’   A. How many Phosphodiester bonds are required to form this segment of double-stranded DNA? B. How many hydrogen bonds are present in this DNA segment?

3. For each of the following characteristics, list all of the bases (A, B, C, or D) to which they apply. (a) A signal that identifies a parental DNA strand in the MutH,L,S mismatch correction system (b) Most likely to be involved in cyclobutane dimer formation after A B D HN-CH3 o-CH3 NH2 CH3 CH3 HN HN ultraviolet irradiation of DNA H,N (c) A methylated base found immediately to the 5' side of dGMP residues in eukaryotic DNA

18. If 32P is used to label both strands of double-stranded DNA, after two rounds of replication, four double-stranded molecules of DNA are produced. Of these,a. one of the four double-stranded molecules of DNA will contain all the 32Pb. two of the four double-stranded molecules of DNA will contain 32P, each with half of the 32Pc. three of the four double-stranded molecules of DNA will contain 32P, each with 1/3 of the 32Pd. all four double-stranded molecules of DNA will contain 32P, each with ¼ of the 32Pe. none of the double-stranded molecules of DNA will contain 32P

2. Dr. Kim at Ewha Research Center performed shotgun Sanger sequencing on an unknown DNA sample, and obtained the following reads (12 reads). Since the length of each read is quite short, Dr. Kim ran the original sample in a gel electrophoresis, and realized that the original DNA is just 50 base pairs long. (Please note that the resolution of gel electrophoresis is not so good. Thus, we cannot figure out the exact length of DNA using gel electrophoresis in the real world.) 1) САСТС ССAGT GTACC T 3) GGAGT CAАТC GC 5) GGCTG TGCTT GG 7) GATGG CTGTG 9) CAGTG TAССT GCA 11) TGCAA GCCGA G 2) AGCCG AGATG GCTG 4) CTGCA AGCCG A 6) CTTGG AGTCA ATCGC 8) САСТС ССAG 10) GCTGT GСТTG G 12) TGCTT GGAGT (a) Find the sequence of the original DNA (reconstruction), and align each read with the reconstructed DNA sequence. (hint: put all reads on a ppt slide, and move them around to find overlaps.) (b) Calculate coverage at each nucleotide position of the reconstructed DNA, i.e., how many reads cover that…

4

1. From the given DNA strands:a. Identify the template and non-template strand.b. Give the mRNA product when the DNA is transcribed.c. What is the resulting amino acid sequence which will result from the mRNA?

8. What is happening to the DNA molecule in the figure? Also, discuss the types and functions of enzyme participating in this step.

13. a. Draw in the corresponding DNA nucleotide that would base pair with the adenine nucleotide shown below using the same level of detail as provided in the image below. Hint: Remember that DNA bases pair in the antiparallel orientation. орасна you A OH H b. How do you know the adenine nucleotide drawn above is from DNA and not RNA?

1. A DNA fragment was sequenced; however, the scatter-brained professor lost track of the direction of the sequence. The resulting sequence is given, but without the 3' or 5' ends identified. NOTE the sequence listed is double stranded. (a) Find all START codons (in both directions and for both strands) and report the sequence of the two start codon(s) plus the next 3 bases downstream (i.e. 5' to 3' direction) (b) One of the start codons has a STOP codon 5 codons downstream, list the 18 bases that contain the target sequence and the 6 amino acids that this (very short) open reading frame would translate to (c) BONUS: Identify the 3' or 5' ends for lables1- 4 (1) ATATTAAAAAAGGTTTAGGTACGGAACGTCGAAGAGAACTAAACACAAATTAAGTGACAGACAGTTGTC (2) (3) TATAATTTTTTCCAAATCCATGCCTTGCAGCTTCTCTTGATTTGTGTTTAATTCACTGTCTGTCTACAG(4)