
Computer Networking: A Top-Down Approach (7th Edition)
7th Edition
ISBN: 9780133594140
Author: James Kurose, Keith Ross
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Create a c ++
Instructions:
- Write a program to find the maximum of a set of integers within an array.
- The program should ask the user to enter each of the values.
- At the end the program prints a pointer to point to the maximum value.
The example is shown in the image
Note create the program in c ++

Transcribed Image Text:Example
Enter a number of numbers: 4
Enter the values to the array:
3
8
The largest value in the array is: 8
Expert Solution

This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by stepSolved in 3 steps with 1 images

Knowledge Booster
Similar questions
- Programming Language: C++ Please use the resources included and provide notes for understanding. Thanks in advance. Code two functions to fill an array with the names of every World Series-winning team from 1903 to 2020, then output each World Series winner with the number of times the team won the championship as well as the years they won them. The input file is attached, along with the main function and screenprint. Please note team names that include two words, such as Red Sox, have an underscore in place of the space. This enables you to use the extraction operator with a single string variable. The following resources are included: Here is main. #include <iostream>#include <fstream>#include<string> using namespace std; // Add function declarations and documentation here void fill(string teams[], int size);void findWinner(string teams[], int size); int main(){ const int SIZE = 118;int lastIndex;string team[SIZE]; fill(team, SIZE);findWinner(team, SIZE); return…arrow_forwardTask - Using pointers to process arrays (C Language) Example #5 below expected output is 45, but from the program below its coming out to 46. Please help make it come out to 45 as expected In a TV show, each minute can be either interesting or boring. Assume that if 7 consecutive minutes are boring, then an average viewer will stop watching the show. Write a C program that calculates how many minutes that an average viewer will watch a TV show, given the interesting minutes. Assume the TV shows are 45 minutes long. Requirements Name your program project4_minutes.c. Follow the format of the examples below. The program will read in the number of interesting minutes, then read in the interesting minutes. The program should include the following function. Do not modify the function prototype. int find_minute(int *minutes, int n); minutes represents the input array for interesting minutes, n is the length of the array (the number of interesting minutes). The function returns the how…arrow_forwardProblem Statement – You are to create a program to play Tic-Tac-Toe. The program should initially explain that this program is a Tic-Tac-Toe game. The program must include the following: The board must be represented as a one dimensional array. The board must be printed after each user selects a position on the board. Directions must be printed to the screen. The directions should include a copy of the board with each position labeled in the board. The game should allow two players to alternate providing their selected position. The first player will be using ‘X’ and the second player will be using ‘Y’. The program should include the following functions: void printDirections ( ) Provides directions on how to play the game int getBoardPosition( int player) This function prompts for the player to input the position of the board and returns the position. void printBoard (char board [ ] ) This function prints the updated board with the input of the player. int isWinner ( char board […arrow_forward
- Please written by computer source (java)arrow_forwardC++ Coding: ArraysTrue and False Code function definitions for eoNum() and output(): Both eoNum() and output() are recursive functions. output() stores the even/odd value in an array. Store 0 if the element in the data array is even and store 1 if the element in the data array is odd. eoNum() displays all the values in an array to the console.arrow_forwardC++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…arrow_forward
- C++ Write the program that outputs the following menu. The program should allow a user to input numbers into an array of integers. The array size should be 10. The first number should be stored in the zero position of the array. The next number should be stored in the next available location. Each option below should be written using a procedure, except Quit. Remember to comment the procedures with (given, task and return). (MENU) 1) Input number. 2) Sort numbers. 3) Output numbers 4) Quit Option 1) Allows the user to input a number and store it into the array. If the array is full no more numbers should be input. When the user select option 1 and the array is full it should output (Memory Full!). This option will only allow one number to be entered. If the user want to input another number they will need to select option 1 again. Option 2) This option should take the array and sort it in ascending order. Use the selection sort to do this. Option 3)…arrow_forwardProgramming Language: C++ Please use the resources included and provide notes for understanding. Thanks in advance. Code two functions to fill an array with the names of every World Series-winning team from 1903 to 2020, then output each World Series winner with the number of times the team won the championship as well as the years they won them. The input file is attached, along with the main function and screenprint. Please note team names that include two words, such as Red Sox, have an underscore in place of the space. This enables you to use the extraction operator with a single string variable. The following resources are included: Here is main. #include <iostream>#include <fstream>#include<string> using namespace std; // Add function declarations and documentation here void fill(string teams[], int size);void findWinner(string teams[], int size); int main(){ const int SIZE = 118;int lastIndex;string team[SIZE]; fill(team, SIZE);findWinner(team, SIZE); return…arrow_forwardProgramming Language: C++ I really need help with this question and I keep getting repost answers. Please, someone, help with a genuine understanding of the problem. Code two functions to fill an array with the names of every World Series-winning team from 1903 to 2020, then output each World Series winner with the number of times the team won the championship as well as the years they won them. The input file is attached, along with the main function and screenprint. Please note team names that include two words, such as Red Sox, have an underscore in place of the space. This enables you to use the extraction operator with a single string variable. The following resources are included: Here is main. #include <iostream>#include <fstream>#include<string> using namespace std; // Add function declarations and documentation here void fill(string teams[], int size);void findWinner(string teams[], int size); int main(){ const int SIZE = 118;int lastIndex;string team[SIZE];…arrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- Computer Networking: A Top-Down Approach (7th Edi...Computer EngineeringISBN:9780133594140Author:James Kurose, Keith RossPublisher:PEARSONComputer Organization and Design MIPS Edition, Fi...Computer EngineeringISBN:9780124077263Author:David A. Patterson, John L. HennessyPublisher:Elsevier ScienceNetwork+ Guide to Networks (MindTap Course List)Computer EngineeringISBN:9781337569330Author:Jill West, Tamara Dean, Jean AndrewsPublisher:Cengage Learning
- Concepts of Database ManagementComputer EngineeringISBN:9781337093422Author:Joy L. Starks, Philip J. Pratt, Mary Z. LastPublisher:Cengage LearningPrelude to ProgrammingComputer EngineeringISBN:9780133750423Author:VENIT, StewartPublisher:Pearson EducationSc Business Data Communications and Networking, T...Computer EngineeringISBN:9781119368830Author:FITZGERALDPublisher:WILEY

Computer Networking: A Top-Down Approach (7th Edi...
Computer Engineering
ISBN:9780133594140
Author:James Kurose, Keith Ross
Publisher:PEARSON

Computer Organization and Design MIPS Edition, Fi...
Computer Engineering
ISBN:9780124077263
Author:David A. Patterson, John L. Hennessy
Publisher:Elsevier Science

Network+ Guide to Networks (MindTap Course List)
Computer Engineering
ISBN:9781337569330
Author:Jill West, Tamara Dean, Jean Andrews
Publisher:Cengage Learning

Concepts of Database Management
Computer Engineering
ISBN:9781337093422
Author:Joy L. Starks, Philip J. Pratt, Mary Z. Last
Publisher:Cengage Learning

Prelude to Programming
Computer Engineering
ISBN:9780133750423
Author:VENIT, Stewart
Publisher:Pearson Education

Sc Business Data Communications and Networking, T...
Computer Engineering
ISBN:9781119368830
Author:FITZGERALD
Publisher:WILEY