Q: i am confused on which question you answer
A: 26. Cognitive health for a 80 years old patient should include: Cognitive health is just one feature…
Q: What type of talk typically has to decrease before a client will start to express more change talk?
A: Change talk and maintain talk both exhibits a person's reluctance toward change on opposite ends of…
Q: How do commensalism affect each other
A: Any relationship or interaction between two dissimilar organisms is known as symbiosis. The specific…
Q: Rubbing lavender essential oil on the _______ has been shown to relieve depression, anxiety and…
A: Lavender is a herb popular for its attractive flower of purple color with flower aroma. It has been…
Q: What did Maurice Wilkins’ work before working with Rosalind Franklin? What event changed Maurice…
A: Wilkins studied biological molecules like DNA and viruses using a variety of microscopes and…
Q: You must Answer no.6 to no. 9. Multiple Choice only. No need to explain each answer. Provide a…
A: All life on earth began from the universal last common ancestor which lived 3 to 4 billion years…
Q: Please answer these question with full explanation and labal the answers so i know which answer goes…
A: Osmosis is the process by which solvent molecules move from a region of higher concentration to a…
Q: .Choose the correct sentence Does you have much sugar? We used noun phrase in the place of noun to…
A: Figure of speech It refers to the deviation from standard usage of words in order to improve their…
Q: Would you be able to assist with questions 3 and 4? (I know that will count as two questions)
A: Mutations in the DNA happen at random and are not directed in any way to bring about a positive or…
Q: Three legal obligation of students according to PHIPA
A: Health Information Protection Act 2004 has 2 components, one of which is PHIPA(Personal Health…
Q: Observations and inferences are
A: In descriptive research, observation is defined as the primary source of data collecting. In the…
Q: Which one is right and wrong and what might be the correct answer
A: The control and coordination of the body in humans are done by two systems: the nervous system and…
Q: psychologist help the person with the condition
A: The syndrome is a normal effect that occurs in the body. a syndrome is the onset of a disease that…
Q: Clinical psychology
A: Psychology has many branches that are as follows:1)Abnormal psychology 2)Behavioural psychology…
Q: e show your work how you got the answer
A: Physician order alpazolam=0.5mg PO PO means medicines taken by mouth twice a day 0.5mg means…
Q: Question 74 Which of the following is an important nursing responsibility related to pain?…
A: A nurse is a qualified professional who plays a critical role in the health care by providing…
Q: Multiple Choice and Essay
A: Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…
Q: When a person fears another enough to act or behave differently than he would otherwise, the source…
A: In 1959,French and Raven described power under the following heading Coercive Power Reward power…
Q: 1. Explain the role of Statistics in biological science.
A: Statistics is the science of collecting, analyzing, presenting, and interpreting data.
Q: Choose the one most appropriate answer for each.
A: Chemical reactions that take place in the biological systems are defined as metabolism. Metabolism…
Q: Do sentences a and b have different meanings? If so, how are they different? 1 a If I'm too tired, I…
A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…
Q: During rest, an adul
A: The heart rate is the number of times the heart beats in a minute. The heart pump blood with oxygen…
Q: Is the answer?False or true
A: Fetus An unborn baby at early stages are called an embryo. The one which develops from an embryo…
Q: What is the best option?
A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…
Q: Choose the correct response based on the figure:
A: The figure is showing a weighing balance.
Q: number 2, 3 and 4. If you cant answer all the numbers then it's okay.
A: Q.2 Difference between cat and dog : Carnivorousness : Dogs are scavenging carnivores meaning dogs…
Q: Can some please answer this
A: The Green plants prepare their own food from carbon dioxide and water in presence of sunlight is…
Q: Figure C
A: Heart is the main organs of the circulatory system. Human heart is more complex and advanced as…
Q: When you get a “stuffy nose” due to an allergy, cold or sinusitis, your food becomes tasteless.…
A: Taste and smell are the perception of chemicals in the air or in our food. Taste and smell are…
Q: please give answer in simple language and draw diagram where necessary
A: The stereochemistry of phospho acyl glycerol is such that they have a hydrophobic end as well as a…
Q: What hobbie/s can you engage in, describe it, where and when can you do it?
A: Hobbies may play an important role in modern days to take a break from the stress of daily life .
Q: Just match tha following with minimum explanation Do not insert any image type your answer and…
A: Consistency of association- B. Ethics and feasibility often limit application of this criterion in…
Q: Why having a good attitude important for meditation . Give an explanation and example
A: Alternative medicine It is different from traditional medicine. Traditional medicine focuses on…
Q: * .Choose the correct sentence Does you have much sugar? We used noun phrase in the place of noun to…
A: Answer : the sentences given are not correct. The correct sentences are : 1) Wrong sentence :…
Q: Answer all the question. Just choose the letters.
A: Note: Since you have asked for multiple subparts, we will solve the first three for you. If you want…
Q: why it is important for pharmacy to have a door that automatically opens as someone approaches it…
A: Automatic doors can help individuals save energy and resources by lowering the yearly heating and…
Q: Which is better teaching in hospital settings or school setting?
A: Teaching is a profession which help the students and ones who seek knowledge Different methods of…
Q: i submitted this question twice and i got different answers
A: Enzymes are biocatalysts which increase the rate of biochemical reactions. And the activity of…
Q: What is the art of persuasion? rhetoric pathos ethos logos
A: The answer is Rhetoric
Q: Your body can be stressed by ............ . Fill in the blank with the right answer. a. cold…
A: Stress is the condition of physical or emotional tension in the body. It can be caused by various…
Q: Which question can the students answer using the information in the Punnett square
A: genetics is the study of gene , their segregation , linkage , traits and all aspects of chromosomal…
Q: The _______________ area is distal to the _____________ area. Group of answer choices carpal,…
A: The knowledge about anatomical positioning to study the human anatomy is very much important.…
Q: What random act of kindness toward strangers would you do? Do you think you will carry out the act…
A: Random acts of kindness can lift up anyone’s spirits, and you hold the power to make someone’s day…
Q: Make a 3-sentenced paragraph on how the nervous system helped in maintaining homeostasis (balance)…
A: The nervous system comprises the brain, neurons and spinal cord. The nerves are responsible for…
Q: I need the answers for others questions
A: Please Note: As multiple questions have been asked, We would be able to answer question number…
Q: What is Reciprocation when it comes to influencing someone to do something
A: There are 6 principles that were introduced by Robert Cialdini and one among them is the reciprocity…
Q: What is the best choice ?
A: Penicillin is popularly used antibiotic to treat staphylococci and Streptococci bacterial…
Q: which statements are False
A: Glucose is the ultimate source of energy for humans which is metabolized and converted into pyruvate…
Step by step
Solved in 2 steps with 1 images
- The diagram below depicts an active transcription bubble after a short period of RNA synthesis during the transcription process of a prokaryotic gene. Redraw the diagram and label parts (i) to (v) on the diagram. Motivate your answers. (i) the template and the non-template strands; (ii) the orientation (direction) of both DNA strands and that of the newly synthesised RNA strand; (iii) the location of a possible promotor sequence; (iv) the location of a possible Shine-Dalgarno sequence; (v) the specific area of activity of a RNA polymerase.Given the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'
- 2a) Suppose you have a gene in which a single base substitution has created the nonsense mutation 5'TAA3' (which will be transcribed into 5'UAA3' in the mRNA - but recall that mutations are changes in the DNA sequence). Name all the amino acids that could have been coded for by the original, unmutated codon at that position in the gene.c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the left but is not shown): 5'-CAATCATGGAATGCCATGCTTCATATGAATAGTTGACAT-3' 3'-GTTAGTACCT TACGGTACGAAGTATACTTATCAACTGTA-5' i) By referring to the codon table below, write the corresponding mRNA transcript and polypeptide translated from this DNA strand. 2 Second letter с A UUUPhe UAU Tyr UAC. UGU UGCJ UCU) UCC UCA UUG Leu UCG Cys UUC UUA Ser UAA Stop UGA Stop A UAG Stop UGG Trp G CUU CÚC CCU ССС CAU CGU His САC Pro CC CỦA Leu ССА CAA Arg CGA CUG J CCG) CAG Gin CGG AUU ACU AAU Asn AGU Ser AUC le АСC АCА AAC AAA AGC. Thr JArg AUA AGA AUG Met ACG AAG Lys AGG. GAU Asp GUU) GCU GCC GCA GCG GGU" GGC GGA GGG GUC Val GUA GAC Ala Gly GAA Glu GAGJ GUG ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in deletion of the C:G base pair, what will be the resulting amino acid sequence following transcription and translation? Third letter DUAG DUAG DUAG A. First…1.) Define transcription and translation. How does transcription and translation differ in prokaryotes vs. eukaryotes (i.e. What is present in one but not the other)? 2.) What it means when we say that genetic code is redundant? 3.) Describe the stages of transcription (in detail for each step) - what components are required? 4.) Describe the stages of translation in eukaryotes (initiation, elongation, termination)
- 5' AGGGUUUGGGAUGAAUCGACGACGAUCCUACGUACUAAGUA 3' Write the amino acid sequence for this portion of the coding sequence: Write the double-stranded DNA sequence that corresponds to the MRNA above. Label 5' and 3' ends. Would transcription have occurred using the top or bottom strand as the template? Imagine you discover a mutation in the DNA, within the coding sequence of the corresponding mRNA above. You determine that the mutation does not result in a change to amino acid sequence. What is the most likely reason for this?The following is a portion of an mRNA sequence: 3’ –AUCGUCAUGCAGA-5’ a)During transcription, was the adenine at the left-hand side of the sequence the first or the last nucleotide used to build the portion of the mRNA shown? Explain how you know. b)Write out the sequence and polarity of the DNA duplex that encodes this mRNA segment. Label the template and coding DNA strands. c)Identify the direction in which the promoter region for this gene will be located.1. The nontemplate strand of a segment of double- helical DNA contains the sequence: (5')CGCTATAGCGTTTAG (3') (a) What is the MRNA base sequence that can be transcribed from this double helical DNA assuming you already have a ready RNA polymerase present and everything else needed for RNA transcription? Label the sequence ends and list what is required for RNA Pol to work. (b) What amino acid sequence could be coded by the MRNA in (a)'s answer assuming the AUG start codon is just upstream of the MRNA (not shown in the sequence provided)? Use table in Figure 27-7 of the Lehninger 7 th ed "Dictionary of amino acid code words in mRNAs" and write the peptide according to standard convention with abbreviations for the amino acids. (c) If the wrong strand was transcribed and then translated from the section of double stranded DNA shown above, what would the resulting amino acid sequence be? What would the mRNA sequence be? Explain your answer and label all strands. A. First letter of codon…
- 1. The nontemplate strand of a segment of double- helical DNA contains the sequence: (5')CGCTATAGCGTTTAG (3') (a) What is the MRNA base sequence that can be transcribed from this double helical DNA assuming you already have a ready RNA polymerase present and everything else needed for RNA transcription? Label the sequence ends and list what is required for RNA Pol to work. (b) What amino acid sequence could be coded by the mRNA in (a)'s answer assuming the AUG start codon is just upstream of the MRNA (not shown in the sequence provided)? Use table in Figure 27-7 of the Lehninger 7 th ed "Dictionary of amino acid code words in mRNAs" and write the peptide according to standard convention with abbreviations for the amino acids. (c) If the wrong strand was transcribed and then translated from the section of double stranded DNA shown above, what would the resulting amino acid sequence be? What would the MRNA sequence be? Explain your answer and label all strands. 歐歐队 相阳阳一即即的 9 First letter…I'm studying Transcription in bacteria, my textbook writes that: "the holoenzyme “explores” a length of DNA until it encounters a promoter region and binds there to about 60 nucleotide pairs along the double helix, 40 of which are upstream from the point of initial transcription. Once this occurs, the helix is denatured, or unwound, locally, making the template strand of the DNA accessible to the enzyme." my question is what proteins or factors unwind the helix?The following represents a transcription unit in a hypothetical DNA molecule in E.coli. (Transcription can use either strand, but by convention we always put 5’à 3’ on the top.) 5’…..TTGACANNNNTATAAT…3’ 3’…..AACTGTNNNNATATTA…5’ If this molecule is transcribed from left to right, then the ____ strand will be the template strand and the ___ strand will be the non-template strand. top, bottom bottom, top