Can someone please mix the mRNA and animo acid sequence I messed up ,please just put it in the corrected order thank you!

Q: omplete what is being asked and finally with the Genetic Code table, determine what specific amino…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: c) What are essential fatty acids? What type of geometrical isomerism plays a vital role in…

A: In the recent two decades or more, lipid research in the life sciences has regained popularity,…

Q: DNAT  A  C       C  A  C        C  C  C       C  G  T         A  T  G        G  C  T      G  G  G…

A: DNA and RNA acts as a genetic matter that carry the genetic information from one generation to…

Q: 1. What is a codon? 2. For eaxh of the following mRNA codons, give the tRNA anticodon and determine…

A: Central dogma of cell comprises of two important processes. They are transcription of DNA into mRNA…

Q: Directions: Study the DNA sequence below and answer the questions. Use a separate paper for your…

A: Each organism's DNA sequence is unique. Its base-pair sequence might vary from time to time. It is…

Q: If 20% of the DNA in a guinea pig cell contains adenine nucleotides what percentage is cytokines…

A: A DNA double helix is formed by complementary pairing of bases, Purine bases bonding with…

Q: CGA CUA CCA UCA ACA GUA GGA GGC CCGC AUA CUC CCC UCC ACC GUC 3 CGG GAC AAC UGC GAA CAA GGG CAC AUC…

A: The process of synthesis of proteins with the help of messenger RNA is called translation. Proteins…

Q: DNA Fingerprints Cat Kittens IL || ILL || I I

A: DNA fingerprinting is a technique used to compare sequences in genomes using satellite DNAs like…

Q: The codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine,…

A: CENTRAL DOGMA:- The whole process of Central Dogma involves two processes:- 1) Transcription- When…

Q: Second letter of codon U U UC UA UG U CU CC CA CG First letter of AU AC AA AG codon (5'-end) GU GC…

A: The genetic code may be defined as a collection of principles that living cells use to translate…

Q: 6. Identify the DNA sequence below. Write the DNA sequence in 5' to 3' orientation.

A: The DNA (deoxyribonucleic acid) sequence is the order in which the nucleotide bases are arranged.…

Q: When referring to the amino acid sequences of proteins, sequence homology is the same as sequence…

A: single mutation leads to a homologous protein, and yet may drastically change the structure and/or…

Q: Transcribe the strand into MRNA: CTA-ATA-AAA-CGG Your answer

A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…

Q: Create the complementary DNA strand: ACC-GCC-TAG-GCA Your answer

A: Complementary DNA (cDNA) is a copy of DNA from the mRNA molecule produced through a reverse…

Q: Cxikeria DNA Transcription Translation Location

A: The central dogma, central to the cellular process functions in transcription by conversion of DNA…

Q: Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that…

A: Mutation is defined as the change in the nucleotide sequence of DNA.

Q: The process of transcription is represented by letter

A: DNA is transcribed into mRNA and mRNA is translated into protein.

Q: Once you have cut your circular DNA it becomes linear and you need to insert/glue the functional…

A: Recombinant DNA technology It is a technique that alters the phenotype of an entity(host) when a…

Q: What does "indel" stand for? Group of answer choices internal/deleterious insertion/deletion…

A: Indel is a term related to molecular biology and is responsible for causing small variation in the…

Q: If a protein was made up of 12 amino acids, how many nucleotides would make up the DNA message…

A: DNA( Deoxyribonucleic acids) is made up of two polynucleotide chain that winds around each other and…

Q: The diagram below depicts an active transcription bubble after a short period of RNA synthesis…

A: Transcription involves the copying of information from a strand of DNA into a new molecule of…

Q: What amino acid does the codon AGC code for? Use the chart below. Thr (threonine) Arg (arginine)…

A: Genetic code was discovered by crick. It is the sequence of nitrogen bases in mRNA molecule which…

Q: Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT

A: By the process of transcription the DNA strand is transcribed into mRNA within the nucleus of the…

Q: re 52 codons but only 51 amino acids in this protein. Why? (please refer to the attachment - the…

A: The basic building block of the nucleic acid id known as the nucleotides. The messenger RNA and DNA…

Q: Complete the sentences. Each term may be used more than once. In a circular bacterial chromosome,…

A: The structure and behavior of DNA play a crucial role in the functioning of living organisms. In…

Q: Pre-mRNA processing takes place in

A: EXPLANATION In bacteria, transcripts RNA are ready to function as messenger RNAs and translated into…

Q: For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and…

A: Translation is a technique which refers to the process of translating mRNA sequence into amino acid…

Q: What is the: 1. Complementary strand & mRNA sequence 2. Amino acid sequence 3. Identify the…

A: What is the: 1. Complementary strand & mRNA sequence    3' -TAC- CAG -GTT -ACC -AGT- 5'…

Q: Fill in the blanks: DNA fragment A is 3' AGC CCG CTC CGA GGC TAA AAG CGT 5' is % of guanine in DNA…

A:

Q: Below is a schematic of the molecule that inserts the fourth amino acid (a trytophan) into the…

A: tRNA is a transfer Ribonucleic acid molecule that helps decode the mRNA sequence to convert it into…

Q: Which of the following mechanisms can cause two different proteins to be produced from the same…

A: Some popular genes produce various proteins from a solitary piece of RNA or DNA by using diverse…

Q: Translate to amino acids the strand using the Genetic Code chart. Remember to use the start and stop…

A: mRNA or messenger RNA contain the genetic codons that must be translated into amino acid chain…

Q: TNIS IS the SC TAC-ATA-ACG-CGA-CAA-CTA-AAA-ACT Write the amino acid sequence of the protein that…

A: Here DNA sequence is given is TAC-ATA-ACG-CGA-CAA-CTA-AAA-ACT This DNA strand work as a template…

Q: A TRNA molecule with the anticodon GCU would be carrying the amino acid: Secend ha f cod Three-er…

A: Ribonucleic acid (RNA) comprises a Ribose sugar along with a phosphate group and nitrogenous bases.…

Q: Innoor an A |RROTEL HERE........god ba

A: In this question we have to describe about the process of translution.

Q: Can you please check my answer and make sure it is correct. Question: List the ingredients of master…

A: Polymerase chain reaction (PCR) is a technique to amplify the DNA. For successful PCR, the following…

Q: Genetics of Sickle Cell Anemia I Tools Add-ons Help Last edit was 3 minutes ago nal text Comfortaa В…

A: Sickle Cell anaemia is an autosome linked recessive trait that can be transmitted from parents to…

Q: Question S end shoephete adre GLare H H oyaene Pyimdine bemes HO OH a. Label the strands as being…

A: Biomolecules also known as biological molecule is any of the numerous substances that are produced…

Q: Build up your DNA Tom there your MRNA and your protelm 3 ATATTIT TACTTCAAACOGATT AUGAAGUUUGGCUAA Met…

A: So, the given DNA sequence is ATTTT TACTTCAAACOGATT In a DNA molecule four base pairs are involved…

Q: DNA mRNA Amino Acids ATC-TAC-AGC-TTC-CCG-TGA-ACT

A: DNA (deoxyribonucleic acid) is the genetic material present inside the cells of all living…

Q: One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base…

A: The given strand represents the complimentary strand of DNA. The complimentary strand. Given the…

Q: An RNA sequence includes 15 codons. How many amino acids does this sequence encode? O 3 05 15 O 45

A: Genetic code is a combination of rules, which allows the translation of information encoded in the…

Q: 4. What is the nitrogen base pair of Adenine in transcription? * Cytosine O Uracil O guanine thymine…

A: Nucleic acid is biological macromolecules that is exhibited inside the nucleus is the cell. It…

Q: UCAQ UC AG UGA0 UC UCAG GUC UOPO AC Alanine Tyrosine Stop A GU Valine Y Cysteine G A Stop AG AC A G…

A: Genetic Code The genetic code is the relationship between the sequence of basis in DNA or its mRNA…

Q: Align your two superimposed fragments and look for a repeat

A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…

Genetic Evolution

Sexual reproduction produces distinct population variations. Heredity determines the traits and qualities to be passed down to the progeny. Over time, this variation within-species is also affected by the process of human evolution. The study of how genetic variation leads to evolutionary changes is known as genetic evolution. If a trait helps an organism to survive and reproduce, it is more likely to be passed down the generations. It is rare that such traits result in a completely distinct set of traits in descendants than the ancestral population; this can result in the emergence of a new species.