Q: Question 3. Which of the following dictates the number of trophic levels or feeding levels? a.…
A: Food chain is basically the transfer of energy from one organism to other in an ecosystem Types of…
Q: Central African chimpanzees (Pan troglodytes troglodytes) and bonobos (Pan paniscus) are two…
A: The events that are responsible for the evolution of species from the ancestral population is called…
Q: Predict what might happen if microorganisms began releasing methane. How will this affect the…
A: A greenhouse gas is a gas that ingests and radiates energy inside the thermal infrared range,…
Q: GC-MS can be used to separate and identify proteins, and HPLC is commonly used to separate lipids…
A: GC-MS can be used to separate and identify proteins, and HPLC is commonly used to separate lipids it…
Q: Your short answer should be 2-5 sentences depending on the question. (Ch. 53). Please answer both…
A: The growth curve is an important part of a population which indicates the stability and…
Q: When a neurotransmitter-filled vesicle is in the primed position, which t-SNARE connect is critical…
A: Synapses are structures or junctions that facilitate the passing of an electrical or a chemical…
Q: DO NOT COPY IN GOOGLE OR BARTLEBY QUESTION: Why is there a need for replica plating? How is…
A: Replica plating is technique related to microbiology. In replica plating colonies inoculated into…
Q: What is the significance of the behavior of the vectors that allow La Crosse encephalitis to persist…
A: La Crosse encephalitis is a viral illness that is caused by mosquitoes. This illness is transmitted…
Q: How is it not The anterior cerebral artery?
A: Anterior cerebral artery is The anterior cerebral artery (ACA) is one of two cerebral arteries( the…
Q: In flies, long wings (W) are dominant to short wings (w). Two homozygous recessive are crossed.
A: Genetic inheritance is the process of transfer of gene from the parent to progeny Factor affecting…
Q: Having a prenegotiation meeting in the Mushroom simulation is a form of Oe) Authority power O a)…
A: ANSWER) Intra-organizational bargaining is the meeting held within the organisation by considering…
Q: Targeted metagenomics is helping researchers better understand the complex connectios between diet,…
A: As we can see in the pie charts that Bacteriodetes make 35.44% in patients without cekiac disease…
Q: Discuss various alternative treatment methods to overcome drug resistance
A: Drug resistance is a condition in which the effectiveness or therapeutic effect of the drug…
Q: Genomic DNA was isolated from three individuals shown in the pedigree above. Primers were used to…
A: Pedigree charts are used for analyzing the inheritance of certain characters within a family. They…
Q: Are humans different on a species level? only a few somewhat no yes
A: The scientific name of human is: Homo sapiens. It belongs to Mammalia class in chordates. The human…
Q: Animals: -coordinate muscle movement using their nervous systems. -rely on cell walls for support.…
A: Not all animals possess nervous systems, (example: porifera) therefore option 1 is incorrect.…
Q: How might the asymmetry of an embryo change if after fertilization its moved to a restrictive…
A: The application of temperature-sensitive mutants necessitates changing the temperature of the…
Q: Cytotoxic T Cells attack O pathogens, rapid growth and division O pathogens, apoptosis (cell death)…
A: Introduction Immunity is defined as the ability of the body to fight against the pathogens. There…
Q: What are the behaviors that need to be changed? What health promotion actions would help?
A: ANSWER) As the lady is diagnosed with osteoporosis therefore the most important changes which should…
Q: Choose ALL the events listed below that occur in the cytoplasm of eukaryotes. Select one or more: a.…
A: In eukaryotic cell, translation process occurs in cytoplasm. Translation is the process, that…
Q: Coronavirus background and origin
A: Background of coronavirus. COVID-19 is caused by a virus called SARS-CoV-2. It is a member of the…
Q: 1. You are a lead engineer in a cGMP facility that develops and delivers tissue engineering…
A: Globally, myocardial infarction (MI) is one of the leading causes of death. Loss of cardiomyocytes,…
Q: Hybridization can occur between DNA and RNA B. tRNA transcripts must be cleaved by an endonuclease…
A: Introduction DNA and RNA are genetic material of a cell these are made up of nucleotide. change in…
Q: Identify the parts in these plant and animal cells. Human cheek cell, 400x Outermost layer Animal…
A: Image in left upper corner: As human cheek cell is an animal cell, the organelle that contains DNA…
Q: Mosquitoes and ticks transmit pathogens to mammals. For each vector, explain how the life cycle,…
A: The illnesses brought on by vectors are known as vector borne diseases. A vector, such as a…
Q: 2. Using a reference, find the function of smooth muscle tissue in humans and one would find it.…
A: The hollow body organs like the bladder, colon, and stomach all contain smooth muscles. They are…
Q: State how the distribution of bicoid protein changes after fertilization
A: this question from developmental biology. Bicoid protein is special type of protein which is found…
Q: 1. Why are some microorganisms capable of utilizing certain carbohydrates and some are not?
A: Depending on the unique enzymes of each bacterium, different energy sources are used by bacteria in…
Q: 44. Stress weakens our immune system and increases the likelihood we will experience certain health…
A: Malnutrition, also known as malnourishment, is a situation caused by eating a diet that contains…
Q: State a way in which you could figure out all of the genes involved in forming a trait using…
A: The gene is the sequence of nucleotide bases in DNA. These code for a specific protein or a trait in…
Q: Mitochondrial replication and segregation Transmitted only by the mother Affected organs: muscles…
A: Mitochondria are organelles found in the cells of all eukaryotes. They are often referred to as the…
Q: What is NOT true about the function of RNA polymerase? O its rate of activity is similar for all the…
A: Promoter sites are short DNA sequences found in the promoter region of a gene. They act as binding…
Q: Which of the following statements is false about the impacts of climate change? Choose all that…
A: Increased temperatures, severe weather, ice melt, and rising sea levels are just a few of the…
Q: Summarize the evidence regarding the sum of evolutionariy modifications from the given putative…
A: Evolution is the gradual change in the inherited traits of biological populations over many…
Q: In classical Mendelian genetics, how can one check the genotype of a parent (A) expressing the…
A: Allele can be defined as an alternative form of gene.Dominant allele is an allele which hides the…
Q: natural selection
A: Evolution is change in characteristics of species over several generation and relies on natural…
Q: What phenotypes do you think a homozygous tra1hsn animal with a loss of function Egl-1 mutation…
A: The phenotype is the physical appearance or observable trait of an individual genotype. The…
Q: Put the steps of the process of signal transduction in the order they occur (hint - try to decide…
A: The receptors have site for binding of specific ligand. The receptors are of two types: Membrane…
Q: How do you feel about the fact that you (the general public), as of today, can purchase biohacking…
A: CRISPR kits are gene-editing kits that enable users to experiment with the CRISPR/Cas9 gene editing…
Q: Assume two alleles A1 and A2 with known frequencies e.g. p (A1) = 0.7, q (A2)= 0.3 What would be…
A: There is single gene. It has two alleles: A1 and A2. The allelic frequency of A1: 0.7 The allelic…
Q: Hi! I am interested in getting some help with this question. This spectacular animal is a Lesser…
A: Our ecosystem provides home and shelter to various birds, butterflies, and other creatures, they…
Q: A population of bats becomes isolated after colonizing an island, developing a high incidence of a…
A: The population is the group of individuals belonging to the same species and able to interbreed.…
Q: Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what…
A: Introduction The process by which a gene's information is used to produce either RNA molecules that…
Q: Can we just insert a gene on an organism? - In plants, the use of Agrobacterium, we're there any…
A: Transfer of genes is a common component of genetic engineering projects, i. e. DNA transfer between…
Q: Snowy owls are large white birds that normally inhabit the cold northern regions of Canada.…
A: 1. As the food web shown in figure is interconnected, many species will be affected by introduction…
Q: Outline the three major mechanisms of cell fate determination in developmental genetics. please…
A: Mechanisms of cell fate determination. Autonomous specification, conditional specification, and…
Q: From the following DNA strand: AAGCTAGGATTGCC How many codons would be present?
A: A codon is made up of three nucleotides. Such codons are abundant in messenger RNA and consist of a…
Q: What is the resultant ionic movement when stereocilia move towards the tallest kinocilium? Efflux of…
A: Introduction : Around the hair cells of the inner ear are two different kinds of fluid. The fluid…
Q: What are the different anatomical joints used in a block start for a sprint? What is happening at…
A: Sprint athletes brace their feet against starting blocks at the beginning of a race to prevent them…
Q: If the clearance of sodium doubles in a normal person then the following is physiologically likely:…
A: If the clearance of sodium doubles in a normal person: Doubling of plasma sodium will not occur…
Can SARS CoV 2 be transmitted via milk? Support your answer.
Step by step
Solved in 3 steps
- Plsssssssssss helpppppppp I know this is kind of a lot but this is urgent. 1. Describe the chain of infection for SARS-CoV-2; reflect on the symptoms. Then, pls explain ways to break the chain of infection.What is the genotype of a "normal" male with no Hemophilia A? a b с d e X^NY X^n Y X^N X^N X^N X^n X^n X^nCan the SARS CoV 2 be transmitted via milk? Support your answer.Will the plate and breed count of the same milk approximate each other? Why or why not?
- Describe what you think could have been done (i) Internationally and (ii) Locally to better manage the SARS- CoV-2 pandemic. Justify your opinion for each.PLEASE answer in your own words and NOT outside sources thank you! 1. When transfusing an individual with B+ blood with B- blood, it is important to separate the cells from the plasma and administer only the packed cells. Why do you think this is done?lymph nodules have thin capsule thick capsule double capsule regular capsule O devoid of capsule
- please explain SARS-CoV-2 spreads through cell-to-cell transmissionAs a health worker, what can you suggest to the government on how to protect your family and the community against aids/hiv and tubercolosis?Which vaccine did paul offitt help develop along with merk? HPv chickenpox Rotavirus shingles