Homework Help is Here – Start Your Trial Now!
Science
Biology
Based on the change to the nucleóti How did this mutation change the amino acid sequence of the protein? What is the name of the condition/disorder that results from this mutation? What physical change would happen to the red blood cells in an individual with the mutation to their beta hemoglobin protein? 462

Based on the change to the nucleóti How did this mutation change the amino acid sequence of the protein? What is the name of the condition/disorder that results from this mutation? What physical change would happen to the red blood cells in an individual with the mutation to their beta hemoglobin protein? 462

Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:Elaine N. Marieb, Katja N. Hoehn
Chapter1: The Human Body: An Orientation
Section: Chapter Questions
Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...
See similar textbooks
icon
Related questions
Question
FINALLLY FRIDAY Part B: How Mutations Can Lead to Disorders Note: The examples given in this octivity do not represent exact DNA sequences on the genes described. To do so would be impossible as most genes contain over 1000 nucleotides that code for several hundred omino acids which are joined together to form proteins. This activity gives small segments of DNA in each of these genes and DOES demonstrate actual mutations that do occur within them. Gene 1. Beta Hemoglobin Gene (HBB Gene) is an important gene located on human chromosome 11 shown below. This gene plays an important role in the production of hemoglobin, a protein in red blood cells responsible for carrying oxygen in your blood. Part A: Normal Beta Hemoglobin: Using the un-mutated DNA sequence supplied from the HBB gene below, transcribe and translate the DNA into the corresponding arnino ack sequence that forms hemoglobin. NORMAL H866 GENE MUTATED HBB GENE DNA RNA DNA RNA H 1 C C 2 3 11 S 2 3 Chromosome 11 6 7 56 TGAGCT 03 S 00 9 8 9 0 ACT D T 1 1 1 TGAGCTACTGAGCTGAGCTT NP W3 ld this mutation affect an individual's health? 1 13 S5 GAG C 1 36 1 7 16 6 18 7 1 1 S CO 2 O 2 9 UJ 01 2 2 T GAGCAT 3 2 CAG C 2 2 N5 AA Part B: Mutated Beta Hemoglobin: a mutation to the Beta Hemoglobin gene results in a malfunctioning hemoglobin protein in an individual's red blood cells. This condition results in red blood cells which are usually circular becoming sickle shaped (long and skinny). This condition results in the red blood cells not being able to carry oxygen in the blood and is known as sickle cell anemia. Sickle cell anemia can cause a patient to be unable to carry oxygen efficiently. This could cause dizziness, low oxygen in the body, and can cause other symptoms such as infections and fatigue. Using the mutated DNA sequence supplied from the HBB gene above, transcribe and translate the DNA into the corresponding amino acid sequence resulting in sickled red blood cells with dysfunctional hemoglobin. 1 1 222 1 2 AG NW 25 4 3 2 S 71 AD 29 MO 7 3 M N rich 3 3 1 S 9 33 3 3 3 1 NW M M AGCC GAG CTC CT GT GT 3 3 3 S AA Based on the change to the nucleotide sequence of the DNA, what type of mutation occurred to the Beta Hemoglobin gene? How did this mutation change the amino acid sequence of the protein? What is the name of the condition/disorder that results from this mutation? What physical change would happen to the red blood cells in an individual with the mutation to their beta hemoglobin protein? 3 1x UJ 6 3 37 3 5 3 m 00 36 AGCC GAG CTC CT 3 9 7 Novem 4 3 3 m 00 O D 1 4 55 AAA CTT <O C GTGT 4 3 1 → 12 3 of 5 6 ALAIA CITE=
Transcribed Image Text:FINALLLY FRIDAY Part B: How Mutations Can Lead to Disorders Note: The examples given in this octivity do not represent exact DNA sequences on the genes described. To do so would be impossible as most genes contain over 1000 nucleotides that code for several hundred omino acids which are joined together to form proteins. This activity gives small segments of DNA in each of these genes and DOES demonstrate actual mutations that do occur within them. Gene 1. Beta Hemoglobin Gene (HBB Gene) is an important gene located on human chromosome 11 shown below. This gene plays an important role in the production of hemoglobin, a protein in red blood cells responsible for carrying oxygen in your blood. Part A: Normal Beta Hemoglobin: Using the un-mutated DNA sequence supplied from the HBB gene below, transcribe and translate the DNA into the corresponding arnino ack sequence that forms hemoglobin. NORMAL H866 GENE MUTATED HBB GENE DNA RNA DNA RNA H 1 C C 2 3 11 S 2 3 Chromosome 11 6 7 56 TGAGCT 03 S 00 9 8 9 0 ACT D T 1 1 1 TGAGCTACTGAGCTGAGCTT NP W3 ld this mutation affect an individual's health? 1 13 S5 GAG C 1 36 1 7 16 6 18 7 1 1 S CO 2 O 2 9 UJ 01 2 2 T GAGCAT 3 2 CAG C 2 2 N5 AA Part B: Mutated Beta Hemoglobin: a mutation to the Beta Hemoglobin gene results in a malfunctioning hemoglobin protein in an individual's red blood cells. This condition results in red blood cells which are usually circular becoming sickle shaped (long and skinny). This condition results in the red blood cells not being able to carry oxygen in the blood and is known as sickle cell anemia. Sickle cell anemia can cause a patient to be unable to carry oxygen efficiently. This could cause dizziness, low oxygen in the body, and can cause other symptoms such as infections and fatigue. Using the mutated DNA sequence supplied from the HBB gene above, transcribe and translate the DNA into the corresponding amino acid sequence resulting in sickled red blood cells with dysfunctional hemoglobin. 1 1 222 1 2 AG NW 25 4 3 2 S 71 AD 29 MO 7 3 M N rich 3 3 1 S 9 33 3 3 3 1 NW M M AGCC GAG CTC CT GT GT 3 3 3 S AA Based on the change to the nucleotide sequence of the DNA, what type of mutation occurred to the Beta Hemoglobin gene? How did this mutation change the amino acid sequence of the protein? What is the name of the condition/disorder that results from this mutation? What physical change would happen to the red blood cells in an individual with the mutation to their beta hemoglobin protein? 3 1x UJ 6 3 37 3 5 3 m 00 36 AGCC GAG CTC CT 3 9 7 Novem 4 3 3 m 00 O D 1 4 55 AAA CTT <O C GTGT 4 3 1 → 12 3 of 5 6 ALAIA CITE=
Expert Solution
steps

Step by step

Solved in 2 steps

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Knowledge Booster
Hematology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:
9780134580999
Author:
Elaine N. Marieb, Katja N. Hoehn
Publisher:
PEARSON
Biology 2e
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Anatomy & Physiology
Anatomy & Physiology
Biology
ISBN:
9781259398629
Author:
McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:
Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:
9780815344322
Author:
Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:
W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:
9781260159363
Author:
Martin, Terry R., Prentice-craver, Cynthia
Publisher:
McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Inquiry Into Life (16th Edition)
Biology
ISBN:
9781260231700
Author:
Sylvia S. Mader, Michael Windelspecht
Publisher:
McGraw Hill Education
SEE MORE TEXTBOOKS