b. The coding sequence begins with AUG. What does AUG signify in terms of translation? The Standard Genetic Code When RNA polymerase initially transcribes the insulin gene into messenger RNA, two introns - totaling 966 additional nucleotides - are included in the precursor form of the insulin mRNA. These intron sequences are removed from the mRNA in a splicing reaction as the mRNA is being transported out of the nucleus of the cell. You might want to discuss why almost all eukaryotic genes contain introns. 3' 3'- Val 35 (V) Ala (A) G Arg (R) A Ser (S) Lys (K) Asp (D) Glu 0 이 Phe (F) Leu (L) Ser (S) CODOCCAGUCAGUCAGUCAGUC C G A C G A S%vcS\¢ Asn (N) G Thr E A GU C GU AC CUG ACUGACUGAC Met (M) Q A A G Tyr 35 UTO. U G (Y) Cys (C) U C A G Trp (W) 3' U C A G 30 Leu (L) C U Pro ခြာ UG Gln lle Arg (Q) (R) 09 His (H) Start Stop Figure 9: The codon sun shows the coding amino acid for each codon. Working from the inside outward, the first, second and third nucleotides indicate the cognate amino acid of the sequence or stop. Translating mRNA into Protein 11 To translate mRNA into protein, the ribosome recognizes an AUG codon - and begins decoding the mRNA as it moves from left to right (5' to 3') down the mRNA sequence. As a result, all proteins begin with the amino acid methionine (Met, M) at their N-terminal end. In humans and other eukaryotes the ribosome begins synthesizing proteins at the first AUG codon from the 5′ end of the mRNA. Protein Synthesis of Insulin Protein tRNA First Amino Acid (methionine) CCUUCUGCCAGGCCCUGUGG Start Codon 5' End CCUUCUGCC 5' End mRNA Ribosome Ribosome Continues to Translate mRNA into Protein Growing Protein Chain eno na GGCCCU mRNA Ribosome UGGGG 3' End CCUCUGGGG + 3' End Translation Reading Frames 2. Using the codon sun. Translate the first 60 nucleotides in the insulin sequence given above. 1 ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGAC 1 ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGAC 1 20 60 60 Protein processing To make the final protein the polypeptide (chain of amino acids) needs to be processed and folded into the correct shape. During processing, some of the polypeptide is removed because it served as a 'shipping label' telling the cell where to send the polypeptide. For example, insulin is sent to the endoplasmic reticulum to be processed. Once the sequence of amino acids is finalized, the polypeptide now has the correct primary structure. The protein then folds into alpha helixes and beta sheets, which form the secondary structure. The final protein will also have a tertiary structure, which includes stabilizing bonds like disulfide bridges. 3. Using the print out from PDB-101, follow the instructions to fold the insulin. You must include a picture of your final product and your face. 4. Answer the following questions: a. What type of bonds hold the secondary structure, alpha helix and beta sheet, together. b. What is a disulfide bridge? Looking at your paper model how did it affect the structure?

b. The coding sequence begins with AUG. What does AUG signify in terms of translation? The Standard Genetic Code When RNA polymerase initially transcribes the insulin gene into messenger RNA, two introns - totaling 966 additional nucleotides - are included in the precursor form of the insulin mRNA. These intron sequences are removed from the mRNA in a splicing reaction as the mRNA is being transported out of the nucleus of the cell. You might want to discuss why almost all eukaryotic genes contain introns. 3' 3'- Val 35 (V) Ala (A) G Arg (R) A Ser (S) Lys (K) Asp (D) Glu 0 이 Phe (F) Leu (L) Ser (S) CODOCCAGUCAGUCAGUCAGUC C G A C G A S%vcS\¢ Asn (N) G Thr E A GU C GU AC CUG ACUGACUGAC Met (M) Q A A G Tyr 35 UTO. U G (Y) Cys (C) U C A G Trp (W) 3' U C A G 30 Leu (L) C U Pro ခြာ UG Gln lle Arg (Q) (R) 09 His (H) Start Stop Figure 9: The codon sun shows the coding amino acid for each codon. Working from the inside outward, the first, second and third nucleotides indicate the cognate amino acid of the sequence or stop. Translating mRNA into Protein 11 To translate mRNA into protein, the ribosome recognizes an AUG codon - and begins decoding the mRNA as it moves from left to right (5' to 3') down the mRNA sequence. As a result, all proteins begin with the amino acid methionine (Met, M) at their N-terminal end. In humans and other eukaryotes the ribosome begins synthesizing proteins at the first AUG codon from the 5′ end of the mRNA. Protein Synthesis of Insulin Protein tRNA First Amino Acid (methionine) CCUUCUGCCAGGCCCUGUGG Start Codon 5' End CCUUCUGCC 5' End mRNA Ribosome Ribosome Continues to Translate mRNA into Protein Growing Protein Chain eno na GGCCCU mRNA Ribosome UGGGG 3' End CCUCUGGGG + 3' End Translation Reading Frames 2. Using the codon sun. Translate the first 60 nucleotides in the insulin sequence given above. 1 ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGAC 1 ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGAC 1 20 60 60 Protein processing To make the final protein the polypeptide (chain of amino acids) needs to be processed and folded into the correct shape. During processing, some of the polypeptide is removed because it served as a 'shipping label' telling the cell where to send the polypeptide. For example, insulin is sent to the endoplasmic reticulum to be processed. Once the sequence of amino acids is finalized, the polypeptide now has the correct primary structure. The protein then folds into alpha helixes and beta sheets, which form the secondary structure. The final protein will also have a tertiary structure, which includes stabilizing bonds like disulfide bridges. 3. Using the print out from PDB-101, follow the instructions to fold the insulin. You must include a picture of your final product and your face. 4. Answer the following questions: a. What type of bonds hold the secondary structure, alpha helix and beta sheet, together. b. What is a disulfide bridge? Looking at your paper model how did it affect the structure?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 18QP: The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this...

See similar textbooks