b. The coding sequence begins with AUG. What does AUG signify in terms of translation? The Standard Genetic Code When RNA polymerase initially transcribes the insulin gene into messenger RNA, two introns - totaling 966 additional nucleotides - are included in the precursor form of the insulin mRNA. These intron sequences are removed from the mRNA in a splicing reaction as the mRNA is being transported out of the nucleus of the cell. You might want to discuss why almost all eukaryotic genes contain introns. 3' 3'- Val 35 (V) Ala (A) G Arg (R) A Ser (S) Lys (K) Asp (D) Glu 0 이 Phe (F) Leu (L) Ser (S) CODOCCAGUCAGUCAGUCAGUC C G A C G A S%vcS\¢ Asn (N) G Thr E A GU C GU AC CUG ACUGACUGAC Met (M) Q A A G Tyr 35 UTO. U G (Y) Cys (C) U C A G Trp (W) 3' U C A G 30 Leu (L) C U Pro ခြာ UG Gln lle Arg (Q) (R) 09 His (H) Start Stop Figure 9: The codon sun shows the coding amino acid for each codon. Working from the inside outward, the first, second and third nucleotides indicate the cognate amino acid of the sequence or stop. Translating mRNA into Protein 11 To translate mRNA into protein, the ribosome recognizes an AUG codon - and begins decoding the mRNA as it moves from left to right (5' to 3') down the mRNA sequence. As a result, all proteins begin with the amino acid methionine (Met, M) at their N-terminal end. In humans and other eukaryotes the ribosome begins synthesizing proteins at the first AUG codon from the 5′ end of the mRNA. Protein Synthesis of Insulin Protein tRNA First Amino Acid (methionine) CCUUCUGCCAGGCCCUGUGG Start Codon 5' End CCUUCUGCC 5' End mRNA Ribosome Ribosome Continues to Translate mRNA into Protein Growing Protein Chain eno na GGCCCU mRNA Ribosome UGGGG 3' End CCUCUGGGG + 3' End Translation Reading Frames 2. Using the codon sun. Translate the first 60 nucleotides in the insulin sequence given above. 1 ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGAC 1 ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGAC 1 20 60 60 Protein processing To make the final protein the polypeptide (chain of amino acids) needs to be processed and folded into the correct shape. During processing, some of the polypeptide is removed because it served as a 'shipping label' telling the cell where to send the polypeptide. For example, insulin is sent to the endoplasmic reticulum to be processed. Once the sequence of amino acids is finalized, the polypeptide now has the correct primary structure. The protein then folds into alpha helixes and beta sheets, which form the secondary structure. The final protein will also have a tertiary structure, which includes stabilizing bonds like disulfide bridges. 3. Using the print out from PDB-101, follow the instructions to fold the insulin. You must include a picture of your final product and your face. 4. Answer the following questions: a. What type of bonds hold the secondary structure, alpha helix and beta sheet, together. b. What is a disulfide bridge? Looking at your paper model how did it affect the structure?

Briefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNA

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?

The pre-mRNA transcript and protein made by several mutant genes were examined. The results are given below. Determine where in the gene a likely mutation lies: the promoter region, exon, intron, cap on mRNA, or ribosome binding site. a. normal-length transcript, normal-length nonfunctional protein b. normal-length transcript, no protein made c. normal-length transcript, normal-length mRNA, short nonfunctional protein d. normal-length transcript, longer mRNA, shorter nonfunctional protein e. transcript never made

Is an entire chromosome made into an mRNA during transcription?

Alternative Splicing Possibilities Suppose exon 17 were deleted from the fast skeletal muscle troponin T gene (Figure 29.46). How many different mRNAs could now be generated by alternative splicing? Suppose that exon 7 in a wild-type troponin T gene were duplicated. How many different mRNAs might be generated from a transcript of this new gene by alternative splicing?

If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?

The Events in Transcription Initiation Describe the sequence of events involved in the initiation of transcription by E. coil RNA polymerase. Include in your description those features a gene must have for proper recognition and transcription by RNA poIymerase.

Compare bacterial and eukaryotic mRNAs, and explain the functional significance of their structural differences.

Which of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.