a)What is a psychrotroph? (b)From what natural sources would you isolate a thermophile? A psychrophile? (C)How does temperature affect the growth of a microorganism? (D)State the temperature class for Escherichia coli, Bacillus sp, Aeromonas sp, Micrococcus luteus, and suggest their optimum growth temperature. 2 (a)Why is dilution important when determining microbe number? (B)How does a decrease in dye colour intensity affect the microbe ? (C)State the possible sources of error if plate counts and colour intensity of dilutions are incorrect or Precautions taken to prevent this from happening. ( this is not a graded assignment)

Q: What are some of the factors and conditions that affect seed germination? Cite your sources

A: “Note: According to the Q&A guidelines, external sources citations are not allowed to be…

Q: Label the image to test your understanding of virus size relative to other microorganisms.

A: The microscopic infected agent that replicates only inside the living organisms and  outside the…

Q: Since Western and Eastern meadowlarks are similar in appearance, one could assume that both are…

A: a) Phylogenetic species concept: This concept defines a species as a group of individuals who share…

Q: You are a microbiologist, you were using spread plate counts to quantify the effects of a new…

A: The spread plate count is a microbiological technique used to determine the concentration of…

Q: 3 Book References Classify each of the following descriptions by its effect on human population…

A: Population growth refers to the increase or decrease in the number of individuals in a population…

Q: Sympathetic ganglia are proximal to the effector organs and glands are located distal to the spinal…

A: In the intricate web of the human nervous system, the sympathetic ganglia hold a significant place.…

Q: Drag each label into the appropriate bin. Reproduces its own kind Requires another individual to…

A: An earth ecosystem consists of both living and non-living organisms. The abilities for interaction,…

Q: Examine the table of characters given for four different species of flower. Species A Species B…

A: A primitive (or ancestral) character, trait, or feature of a lineage or taxon is one that was…

Q: What are the 3 components of total energy expenditure (TEE)? In the component that makes up the…

A: Total energy expenditure (TEE) is the amount of energy used in a 24-hour period during the oxidation…

Q: carry the father’s genetic information

A: Genetic infromation refers to the informations which is stored in the DNA. DNA can code for proteins…

Q: *In corn a cross is made between two pure breeding lines: red dwarf x green tall. The F1 was light…

A: In the case of plants, true breeding lines are those that have been produced through repeated…

Q: Select two fabrication techniques used to make porous biomaterials for tissue engineering. Provide 2…

A: For the creation of porous biomaterials for tissue engineering, two fabrication techniques have been…

Q: Which of the following are adrenergic fibers? most parasympathetic postganglionic axons most…

A: Sympathetic Autonomic Nervous System: This is the part of the autonomic nervous system in the spinal…

Q: In squirrels, the gray allele (G) is dominant to the brown allele (g) at the coat color locus. A…

A: The principle is the genetic  variation in a poulation will remain constant from one generation to…

Q: efer to the image. A HAURS Gibbon (20 species in 4 genera) Prosimians: Bushbabies New World and…

A: It is a diagram that shows the evolution of various species, organisms from a common ancestor. It is…

Q: See image

A: AACGATGCCATCAGAGCCCAGGACGTGATTTAATTGCTACGGTAGTCTCGGGTCCTGCACTAAATT

Q: What is the lactate threshold?

A: A greater lactate threshold allows an endurance exercise to be continued without the accumulation of…

Q: Question 49 The scientist(s) who showed that DNA contained equal amount of certain nitrogen bases…

A: Question 49The scientist(s) who showed that DNA contained equal amount of certain nitrogen bases…

Q: Part A Mark the location of each antibiotic's action by dragging the labels onto the diagram of a…

A: Numerous mechanisms exist by which antibiotics might affect ribosomes, the cellular machinery in…

Q: Gouty tophus H&E staining Mark the corresponding elements in the pictures 4.1, 4.2 and 4.3: 1 - foci…

A: The study of gouty tophi through Hematoxylin and Eosin (H&E) staining gives a detailed view of…

Q: How is cigarette smoking related to elastase function? Methionine sulfoxide is formed by cigarette…

A: lastase is an enzyme, specifically a protease, that plays a critical role in the breakdown of…

Q: There might be life on Europa because it has an atmosphere that contains oxygen just like the Earth”…

A: Europa is one of Jupiter's biggest moons, renowned for having the fascinating possibility of…

Q: 1. UV light damages DNA by the formation of pyrimidine dimers. Draw the detailed chemical structure…

A: Sometimes there are many accidental lesions formation occurs in DNA, These lesions are temporary…

Q: Spoink is a Pokemon character with a spring tail. It must bounce continuously or it will die.…

A: The allele and genotype frequencies will remain the same generation after generation if the…

Q: Classify each statement as describing DNA replication in prokaryotes, eukaryotes, both, or neither.…

A: DNA replication is a process in which their is synthesis of daughter DNA takes place from parental…

Q: Brown induration of the lungs H&E staining, Perls reaction Mark the corresponding elements in the…

A: The term "induration" refers to the hardening of the lungs. "Hemosiderin" is an iron-containing…

Q: el Which of the following is a comma-shaped, Gram-negative bacterium that acts as a predator on…

A: Bacteria are relatively simple, microscopic and prokaryotic organisms which lack nucleus and other…

Q: Calculate the generation time given the following population data: Ro= 0.601, r = -0.05, Exlxmx =…

A: The generation time of a population is a key parameter in understanding its growth dynamics. It…

Q: Bacteria that prefer to grow at room temperature at low pH are: Mesophilic acidophiles…

A: Bacterial growth is influenced by many factors such as temperature, oxygen requirements, pH, source…

Q: When completing a chart showing the organization of the nervous system, which term should be written…

A: The central nervous system ( CNS) comprises the brain and the spinal cord. The peripheral nervous…

Q: One reason that the osmolarity becomes higher at the bottom part of the loop of Henle is because A)…

A: Henle's loop is a long, U-shaped section of the kidney's nephron tubule found in mammals, birds, and…

Q: Which of the following strategies are used by biological systems to ensure an enzymatic reaction…

A: Enzymatic reactions in biological systems frequently need particular tactics to guarantee their…

Q: A cell is grown on minimal media containing only 3-phosphoglyceric acid as a source of carbon and…

A: Metabolic pathways are a series of chemical reactions that occur within a cell to convert one…

Q: In Drosophila fruit flies, the gene controlling bristle length is X-linked. Wild type flies have…

A: In this particular scenario, we’re examining a gene that controls bristle length, which is X-linked.…

Q: fungus (which is, of course, a eukaryote, that is capable of both meiosis and sexual reproduction).…

A: Saccharomyces cerevisiae is a species of yeast, commonly known as baker's yeast or brewer's yeast.…

Q: what is the flow rate of all kinds of gases that should be receiving to the patient ?

A: A gas flow rate is the amount of gas that travels through a specific spot in a specific amount of…

Q: The ______ controls most of the autonomic nervous system functions and is considered the main…

A: The diencephalon of the brain contains the hypothalamus, which is a crucial regulatory region for a…

Q: Explain why K+ channels not allow Na+ to pass even though Na+ is a smaller ion, and Na+ and K+ are…

A: Potassium channels are specialized membrane-spanning proteins made up of four subunits that create a…

Q: A neurotransmitter that binds to a G-protein-linked receptor, such as a biogenic amine, that…

A: The question revolves around the concept of neurotransmission, specifically focusing on the role of…

Q: A cell is grown on minimal media containing only malic acid as a source of carbon and energy. What…

A: A metabolic cycle is a series of interconnected chemical reactions within a cell that serves…

Q: What is the best desccription for these tissues: Cartilage, Vascular (Blood) Tissues, Reticular…

A: Tissue can be described as a group of similar cells that usually have a common embryonic origin and…

Q: In a DNA double helix, where would you find hydrogen bonds? Between the bases connecting the…

A: DNA or deoxyribonucleic acid is one of the two nucleic acids that serve as the genetic material of…

Q: Original DNA DNA Protein TACGCTATGAGC Methionine-Arginine-Tyrosine-Serine Mutation #1 DNA What type…

A: Mutation is the genetic change in the genome due to the gain or loss of any gene. These changes may…

Q: A common soil fungal species is suddenly detected as an aggressive wheat pathogen, decimating crops…

A: A pathogen is a microorganism, such as a bacterium, virus, or fungus, that can cause diseases in…

Q: A woman and a man have a red-green colorblind daughter. What can you say about the genotypes of the…

A: Color blindness, particularly red-green color blindness, is a sex-linked recessive genetic trait.

Q: Which bacterium is a psychrophilic anaerobe? A. Desulfuromusa B. Flavobacterium C. D. Escherichia E.…

A: Basic introduction to -Psychrophilic anaerobes.Anaerobes are bacterial organisms that can survive…

Q: Transmits sensory signals to the CNS Group of answer choices dorsal root gray commisure ventral root…

A: Transmits sensory signals to the CNS given optionsdorsal root gray commissureventral rootventral…

Q: • Put the name each stages of phagocytosis in the picture below:

A: Phagocytosis is a special type of cellular process that is used for ingestion and eliminating…

Q: 4. Draw a cell in each of the following phases. Be sure to represent the major events of each phase…

A: Mitosis is the stage of the cell cycle in which newly formed DNA is separated and two new cells with…

Q: Imagine you are a college student volunteering for a nonprofit cancer organization that houses…

A: Cancer is a condition characterized by uncontrolled cell growth and division in the body. These…

Modes of Nutrition

It is a biological process of providing or obtaining food that is necessary for growth and health. It includes many physiological processes - absorption, ingestion, assimilation, catabolism, excretion, etc. In biology, the science that deals with nutrition's physiological and chemical processes are called "nutritional science."