Average plaques for bacteriophage A,B,C are 137,36,25. PFU/ml is average plaques multiply by the volume dilution multiply by the dilution factor. Show your working for each bacteriophage.
Q: Why the cells are capable to maintain the homeostasis? 5.- Please name the organelles in the…
A: Cells are the basic building blocks of life, and they must maintain homeostasis in order to survive.…
Q: Give only typing answer with explanation and conclusion how does a hormone regulate the TCA cycle?
A: A hormone is a chemical messenger that is produced by specialized cells in the body and released…
Q: 1.- a) What is a photon? b) In photosynthesis, light energy is transformed into_____________.
A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…
Q: Answer by listing only the name of the disease. Some questions will require the name of the…
A: A bacterial infection is an illness caused by the invasion and multiplication of harmful bacteria in…
Q: mRNAs undergoing degradation are often localised to: Processing bodies Lysosomes Mitochondria The…
A: mRNA degradation is a cellular process that involves the breakdown and removal of messenger RNA…
Q: 4. Name and briefly describe the modes of action of the five major antimicrobial drug groups.
A: Antimicrobial drugs are substances that are used to treat or prevent infections caused by bacteria,…
Q: Draw a whitefish blastula cell in telophase (400x)?
A: The blastula is the stage of embryonic development in which the cells are rapidly dividing by…
Q: B. TIME SPENT IN EACH PHASE OF THE CELL CYCLE Table 14-1. Findings from time spent in each phase of…
A: The cell cycle describes the process by which cells grow, divide, and replicate. It is a highly…
Q: An example sequence corresponds to human sickle cell beta-globin mRNA and that this disease results…
A: In order to find the accession number of the "Homo sapiens hemoglobin, beta (HBB), mRNA" entry, we…
Q: AUGCCGCAAUCUGUUCACGCACUCAUGUG TII CAC & CACICATETE Direction of synthesis- BTTT ATGCCGCA сш TTT…
A: The term "mRNA" is defined as a single-stranded molecule that carries genetic code from DNA used to…
Q: Describe the processing of rRNA
A: Ribosomal RNA (rRNA) is a type of non coding RNA that plays a crucial role in protein synthesis…
Q: Mention the symptoms presented by cows with a limp.
A: Limping is an abnormal gait pattern characterized by difficulty or pain when walking, which causes…
Q: What is the microbiology laboratory test that Identifies Pseudomonas plecoglossicida and what are…
A: Pseudomonas plecoglossicida is a gram-negative bacterium that causes haemorrhagic septicaemia in…
Q: An amino acid is added to the CCA terminus of the tRNA molecule. true or false
A: True, An amino acid is added to the CCA terminus of the tRNA molecule. The CCA terminal of tRNA is…
Q: What information is used by plants to determine if they are growing in the shade or the open canopy?…
A: Growing in a shade or open canopy refers to the availability and intensity of sunlight that a plant…
Q: What benefits may you get from doing medical research online? How do in-person and video-based…
A: Medical research is a broad field that involves the scientific investigation of human health and…
Q: Give typing answer with explanation and conclusion A vacuole that is digesting parts of the cell…
A: A cell is the basic unit of life that makes up all living organisms. It is a complex, self-contained…
Q: ASSIGNMENT UCTIONS AND INFORMATION This assignment consists of five tasks from which you must ch…
A: Note: According to bartleby guidelines only first question is to be answered. Smoking a cigarette…
Q: The information collected in St. Paul can be used to calculate the storage rate for each watershed,…
A: Storage rate = Total flux in - Total flux out. In the above question, the the components of flux-in…
Q: Give typing answer with explanation and conclusion In eukaryotes, repressors can function by:…
A: A repressor is a type of regulatory protein that can bind to specific DNA sequences, known as…
Q: Question 7. When does differentiation occur in sperm development?
A: In the seminiferous epithelium, a complicated series of morphological changes are involved in sperm…
Q: Which of the following statements is not true? a. Some RCTs may involve "cross-over" as part of…
A: Randomized controlled trials (RCTs) are a type of study design that is commonly used in medical…
Q: Record the results you obtained for the following tests and organisms: INDOLE PRODUCTION ORGANISM…
A: The nitrogen reduction test is a biochemical test that is used to determine whether an organism has…
Q: A 35 year old woman of Chinese ethnic background (Guangdong province) presented with a near normal…
A: Summary of results for each family member:
Q: Answer by listing only the name of the disease. 1.A 21 year old woman presents with a swollen…
A: A 21-year-old woman has a big eye puff. It was caused by Chlamydia trachomatis, a germ that makes a…
Q: Define the following: a) Cladogram: b) Clade: c) Node: How do we verify cladograms? Construct a…
A: Evolution is the process by which populations of organisms change over time through genetic…
Q: If a tiny hole is made in a cell membrane, it usually closes over immediately. What feature of the…
A: The cell membrane, also known as the plasma membrane, is a thin, flexible, and selectively permeable…
Q: 3. What are the expected genotype and phenotype ratios in the following genetic conditions? Use…
A: Dihybrid cross is a cross between two hybrid individuals with two traits. Below is the table for…
Q: [word1] is the number of individuals with a genotype who manifest a distinct phenotype? 1-Epistasis…
A: The study of heredity and the variation of inherited traits is referred to as genetics. It deals…
Q: What is known about the genus? Who discovered this species? When and where was your species first…
A: Polyommatus is a genus of butterflies in the family Lycaenidae. It is found in the mountains of…
Q: firstly calculate the rmax. Zebra Mussels Lab 1. Describe the type of population growth observed in…
A: We are examining how many Zebra Mussels grow in Lake Simcoe, Ontario. Zebra Mussels are small…
Q: Which cultures would be suitable for the transduction experiment and why? Which cultures would not…
A: Transduction is a process of gene transfer in bacteria, where bacterial DNA is transferred from one…
Q: What are the names and accession numbers of the top four hits from your BLAST search?
A: BLAST (Basic Local Alignment Search Tool) is a bioinformatics tool used to search a sequence…
Q: Why does TSI contain less glucose than sucrose or lactose? Does an acidic slant indicate that the…
A: The study of tiny creatures' biology includes viruses, bacterium, algal, fungus, slime moulds, and…
Q: Description Label the parts of the kidney seen above.
A: A kidney is a vital organ in the body that is responsible for filtering waste products from the…
Q: Give typing answer with explanation and conclusion which two hormones produced by the pancreas help…
A: A hormone is a chemical messenger produced by the endocrine glands in the body. Hormones are…
Q: What part of cell growth, differentiation, or division does the breast cancer affect?
A: Cancer is a complex molecular disease that can be caused by alternation of genes. Different viral…
Q: The results shown in the accompanying graph support the hypothesis that Toll protein is necessary…
A: Drosophila Melanogaster is commonly called fruit flies and belongs to the group Arthropoda. It is…
Q: Which is not true of Re-entrant Arrhythmias OA. Occurs when there is a "loop" of self excitation. B.…
A: An electrical impulse in the heart that follows a circular course, or re-entrant circuit as opposed…
Q: search for information about rabbits about their use for research, abound in information. put a…
A: Leporidae is a family of small mammals that includes rabbits. Their powerful hind legs, which they…
Q: Which one of the below is the actin- binding unit of troponin complex? A. G-Actin B. TnT C. Tnt D…
A: The troponin complex is three special proteins that help control muscle movement in the heart and…
Q: Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their…
A: The recombinant DNA technology use plasmid to transfer foreign DNA into the host organism in which…
Q: Use the sequences below to determine what type of mutation has occurred by comparing the normal…
A: Any change in DNA sequence is known as mutation that can alter the the amino acid sequence in the…
Q: Fossils of a microscopic organism are found in rocks determined to be from a past era of time.…
A: Cellular respiration is the process by which cells convert nutrients, such as glucose, into energy…
Q: Gross and Microscopic Ⓒ2022 Chamberlain University LLC. All rights reserve distribution without the…
A: The ear is a complex and intricate sensory organ that is responsible for detecting sound and…
Q: Blood viscosity: O A. has the properties of a Newtonian fluid. B. Increases with blood flow…
A: Blood viscosity is the measure of the resistance of blood to flow. It depends on the physical…
Q: For Meal Worm include a header, in-text citation and give the reader background on the relevant…
A: Adult Meal worns reside in dark, cool and moist locations. These locations are usually rich in the…
Step by step
Solved in 3 steps with 3 images
- procedure/s in performing aseptic transfer of bacterial cultures in (include illustration) (2) agar slant culture to agar slantprocedure/s in performing aseptic transfer of bacterial cultures in (include illustration) (3) agar plate to agar slant.BONUS (15 points) The fallowing series of dilution was prepared from a specimen to determine the number of bacteria. There were 62 colonies on the agar plate prepared by transferring 0.3 ml from the tube number 4. Calculate the dilution factors for each tube. What is the cell concentration in the original specimen? Calculate the total number of cells in tube number 2. étv A) F12 F9 F10 F7 % & %3D delete 5 { T Y J K
- The student advises using the same selection procedures and inoculating a 5 mL overnight culture with the transformed cells instead of searching for transformed coli on LB agar plates in order to save time. Why isn't this a wise decision?A bacterial culture was grown for 12 hours. At 4-hour interval, the culture was sampled to determine the population of the culture, by transferring 25 ml of the suspension to 225 ml 0.90% NaCl. Three consecutive dilutions were further made by using I ml aliquot in 9 ml of 0.90% NaCl. One ml from each dilution was plated in each of duplicate plates. The following table shows the results of the plating method. 田 Sampling COUNTS 1st dilution 54; 61 2nd dilution 3rd dilution 4h dilution 1st 3; 7 0; 0 0,0 2nd TNTC TNCT 242: 233 28: 37 3rd TNTC TNTC INTC 249-246 * TNTC = Too numerous to count i. Illustrate the dilution series used and label the final dilution of each dilution. ii. Determine the bacterial count (CFU/ml) every 4 hours of incubation for 12 hours. Show all computations.Special Media for Isolating Bacteria OBJECTIVES Because multiple methods and multiple media exist, you must be able to match the correct procedure to the desired microbe. For example, if bacterium B is salt-tolerant, a high concentration (>5%) of salt could be added to the culture medium. Physical conditions can also be used to select for a bacterium. If bacteri- After completing this exercise, you should be able to: 1. Differentiate selective from differential media. 2. Provide an application for enrichment and selec- tive media. um B is heat-resistant, the specimen could be heated before isolation. Dyes such as phenol red, eosin, or methylene blue are sometimes ineluded in differential BACKGROUND media. Products of bacterial metabolism can react with One of the major limitations of dilution techniques used to isolate bacteria is that organisms present in limited amounts may be diluted out on plates filled with dominant bacteria. For example, if the culture to be isolated has 1…
- a. Explain whether or not any of the methods in fi gure 2.9 could beused to determine the total number of cells present in a patient’s specimen.b. After performing the streak plate method on a bacterial specimen, theculture was incubated for 48 hours at 37°C. Upon viewing the plate, therewas heavy growth (with no isolated colonies) in the fi rst quadrant, but nogrowth was apparent in the remaining quadrants. Please discuss errors in the procedure that could have produced this result.A pure bacterial culture of unknown concentration was diluted to determine the concentration of viable bacteria in the original culture. Serial dilutions were performed as 1. diagrammed below. Each dilution tube contained 400 ul of diluent and 100 ul was transferred into each tube. TSA plates were inoculated with 100 µul from the last three dilution tubes. a. What is the dilution between each tube shown in the diagram below? Express your answer as a ratio. b. What is the total dilution of tube number 5? Express your answer as a ratio. c. What is the concentration of viable bacteria in the original culture? Express your answer using scientific notation and the units CFU/ml. d. What is the concentration of viable bacteria in tube number 2? Express your answer using the units CFU/ml. e. If you inoculated a TSA plate with 250 µl from tube number 5, how many colonies would you expect to see after the plate was incubated? 1 2 3 5 423 80 13 Number of coloniesImagine you have been given a liquid culture of yeast with a starting concentration of 3.67 x 10' cells/ml and are asked to carry out the sample dilution process shown in the figure below. 100μl 100μl 100μl 100μl 100μl 0.9ml 0.9ml 0.9ml H2O H₂O 6.9ml 0.9ml H₂O H₂O H₂O Original 10-1 102 10-3 104 Culture 105 100μl 100μl 100μl Plate A Plate B Plate C a. How many colonies should have been present on Plate A in this example? - Answers must be whole numbers as partial colonies are not expected. b. Imagine you carried out the same dilution scheme shown in the figure above, but now, you do not know the concentration of the original culture. If you counted 163 colonies on Plate B, what is the concentration of cells/ml in the original culture?
- A serial dilution of overnight E.coli culture was performed by pipetting 1ml of a bacterial culture into a 9 ml LB medium. After this, from 10-4 and 10-5 dilution tubes 100µl were plated onto LB agar plates. Upon overnight incubation at 37°C, 200 colonies were counted in 10-4 and 22 colonies were present on 10-5 plates. How many colony-forming units were present per ml of the original culture? If the formula for CFU/ml =no. Of colonies/dilution factor*volume of culture plateTen grams of hamburger were added to 90 mL of sterile buffer. This was mixed well in a blender. One-tenth of amL of this slurry was added to 9.9 mL of sterile buffer. After thorough mixing, this suspension was further dilutedby successive 1/100 and 1/10 dilutions. One-tenth of a mL of this final solution was plated onto Plate Count agar.After incubation 145 colonies were present. How many colony-forming units were present in the total 10 gramsample of hamburger?Assuming that serial dilution was carried out in a laboratory experiment in 6 tubes with 9 ml of saline in each tube and 0.1ml of the stock solution was used for initial dilution, pour plate method of inoculation was performed after the dilution process using 1ml of the culture from the samples from the test tubes. It was found out that on the 6th Petri dish after incubation, there was a total of 16 individual colonies counted. Compute the total number of microorganisms present in tube one, assuming that there was no human error in the transferring proces.