Astronomers have made great strides in sending probes out to other planets and moons in our solar system. If they were to find a living creature some place other than Earth, how could DNA analysis help them better understand the organism? Explain in 1-2 sentences. B I U ⠀

A scientist wants to amplify a short region of the DNA molecule shown below inside the box. Pick the PAIR of primers that can be used in a polymerase chain reaction (PCR) to amplify this fragment 5'TCTTCAAATGTCATCAAAGTGCCACTAGAAAAGAACTCATCGAATACTGAACAACTGTTAAAAAAGCAAAAAATTCTAA 3'AGAAGTTTACAGTAGTTTCACGGTGATCTTTTCTTGAGTAGCTTATGACTTGTTGACAATTTTTTCGTTTTTTAAGATT 5' CAGTTGTT 3' 1. 2. 5' GTTCTTTT 3' 5' AAAAGAAC 3' 3. What is the sequence of 5' TAGAATTT 3' 4. the primer that initiates synthesis of the bottom 5' AACAACTG 3' 5. strand of the indicated DNA region? 5' CAAATGTC 3' 6. What is the sequence of the primer that initiates 7. 5' GTTTACAG 3' synthesis of the top strand of the indicated 5' TTTTCTTG 3' 8. DNA region? 9. 5' TTGTTGAC 3' 5' GTCAACAA 3' 10. 11. 5'ATCTTAAA 3'

You have a locus in your PCR reaction that is a DNA sequence, is on the fifth chromosome, is a single copy locus, and has sequence ID #818. What would its name be according to ISFG nomenclature?

Identify the structures labeled in the image below. The enzyme labeled A is ____. Label B is the _____ strand of DNA, label C is the ____ strand of DNA, and label D are ________