Polyglycine, a simple polypeptide, can form a helix with ϕ = -80°,Ψ= +150°. From the Ramachandran plot, describe thishelix with respect to handedness. Antiparallel B strandsParallel B strands+180PolypeptideIl helix+120+60Left-handeda helixRight-handed -a helix-3, helx-60- 120- 180180-120-60+60+120+180

Name: Polyglycine, a simple polypeptide, can form a helix with ϕ = -80°,Ψ= +
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Polyglycine, a simple polypeptide, can form a helix with ϕ = -80°,Ψ= +150°. From the Ramachandran plot, describe thishelix with respect to handedness. Antiparallel B strandsParallel B strands+180PolypeptideIl helix+120+60Left-handeda helixRight-hande

Ramachandran plot is a plot that shows the dihedral angles psi (Ѱ) and phi (ɸ). These two angles are…

Answered: Antiparallel B strands Parallel B…

Science

Biology

Antiparallel B strands Parallel B strands +180 Polypeptide Il helix +120 +60 Left-handed a helix Right-handed - a helix -3, helx -60 - 120 - 180 180 -120 -60 +60 +120 +180

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 22P

See similar textbooks

Similar questions

3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.
EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .
5’-GTCGTATAGTGA-3’ 3’-CAGCATATCACT-5’ if this is the dna sequence is the RNA sequence this 3’-GTCGTATAGTGA-5’, give reason if it not correct
Translate this RNA sequence into an amino acid sequence: 5'-AUG GGC UAC CGA-3'?
Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?
Please answer both question.its all a one question.otherwise I will give downvote. Below is a double strand DNA sequence contain a gene and it will go under transcription, suppose that the 3/ → 5/ is the template strand: 3/-TAC-GAC-CGT-TGG-CTT-CTG-TGT-AGG-TAT-ACC-GAT-ACT-5/ 5-/ATG-CTG- GCA-ACC-GAA-GAC-ACA-TCC-ATA-TGG-CTA-TGA-3/ 1- Write down the mRNA transcript with direction of ends of the strand? 2- Construct the resulted polypeptide chain from translation of the mRNA above based on the following codons translation below AUG: Methionine GCA: Alanine ACC: Threonine UGA: write its name GAA: Glutamic acid GAC: Aspartic acid CUG: Leucine ACA: Threonine UCC: Serine AUA: Isoleucine UGG: Tryptophan CUA: Leucine
20:201 Foundations Cell Molec 48. The first 17 amino acyl residues in human preproinsulin are H₂N-MALWMRLLPLLALLALW-COOH and the encoding nucleotide triplets ("codons") in DNA are 5'-ATG GCC CTG TGG ATG CGC CTC CTG CCC CTG CTG GCG CTG CTG GCC CTC TGG-3'. Are these molecules written according to their colinearity? A) No. Colinearity is written C-N and 3'-5' for proteins and nucleic acids, respectively. Yes. Colinearity is written N→C and 5'-3' for proteins and nucleic acids, respectively. No. Colinearity is written C-N and 5'-3' for proteins and nucleic acids, respectively. D) There is no such a thing as colinearity. red by ribozymas
The haemoglobin proteins of RNA polymerase ii sub units RPB1-P24928 RPB2-P30876 RPB3-P19387 RPB4-015514 are they similar? Explain?
LS1-1 Which of the following best represents the amino acid sequence found in normal adults with the HBB gene? O His, Gly, Asp, Gly, Gin, Leu, Leu Val, His, Leu, Thr, Pro, Glu, Glu O Val, Gly, Asp, Thr, Pro, Glu, Glu O Leu, Glu, Asp, Gly, Gin, Leu, Leu
#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Arg-ser-ser-ala-pro Possibilities mRNA 3’ AGG UCA UCU GCU CCC 5’ 5’ ACC ACG CCU CCU GGC 3’ 3’ UCC ACG CCU ACU GGA 5’ 5’ CGC UCC CCU GCC CCC 3’ Possibilities coding strand 5’ TCC TCG ACT GCT GGA 3’ 3’ TCC TCG TGA CGA CGC 5’ 5’ CGG ACT ACT GCA CCA 3’ 3’ CCC ACG ACT CCT CGC 5’ Possibilities non- coding strand 3’ GGG TCA TCA CGG GGG 5’ 5’ TCC AGC AGC CGC GGC 3’ 3’ GCC TCA AGC CGA GGA 5’ 5’ TGG TGC TGA AGA TCA 3’
Recombination in Immunoglobulin Genes If recombination between a Vkand Jkgene formed a CCA codon at codon 95 (Figure 28.41), which amino acid would appear at this position?