Answered: Which company is the recommended…

Science

Biology

Which company is the recommended manufacturer for pfSense network interfaces? A. Broadcom B. LSI C. Qlogic D. Intel

Human Physiology: From Cells to Systems (MindTap Course List)

9th Edition

ISBN:9781285866932

Author:Lauralee Sherwood

Publisher:Lauralee Sherwood

Chapter3: The Plasma Membrane And Membrane Potential

Section: Chapter Questions

Problem 7UC: Describe the contribution of each of the following to establishing and maintaining membrane...

See similar textbooks

Related questions

Q: Compare and contrast convergent evolution and evolution by common descent, and give an example of…

A: Evolution is the process by which heritable traits change over time. There are two main types of…

Q: Many fossils existed in one layer of rock, but not in others from different time periods and this…

A: A fossil is the mineralized partial or entire shape of an organism, or of an organism's pastime,…

Q: Humans with gene "R" are 25% more likely to survive tuberculosis than humans with gene "S." What…

A: Tuberculosis (TB) infection is caused by the bacteria Mycobacterium tuberculosis. It is one of the…

Q: Link each term with the correct deﬁnition.

A: Evolution is the gradual change in the inherited traits of natural populations over many…

Q: Which of the following is an example of a visceral stimulus? B. Getting a paper cut O C. A decrease…

A: Introduction Visceral stimulus:- It is a physical reaction to a non-physical experience, an emotion,…

Q: Which very specific synapse will produce the fastest propagation of an action potential? axosomatic…

A: Introduction A synapse is a junction where the axon of one neuron cell contacts another. Two types…

Q: If you are trying to set up a PCR with a total volume of 40uL and you have access to a stock…

A: Inroduction DNA replication occurs in our body. But PCR or polymerase chain reaction is a…

Q: == What was the order of the pigments on the chromatography paper from the bottom up? Postlab 6.13…

A: The chromatographic technique is based on the interaction of solute and solvent molecules. By the…

Q: Give an example in your daily activities that illustrates each level of organization of ecological…

A: The "niche" of an organism is characterized by the set of conditions, resources, and interactions it…

Q: what is the function and origin of this DNA sequence (use BLAST and NEBcutter)?…

A: Introduction Genes are the main regulatory sequence of nucleotides found in the nucleus which…

Q: 9. The irritation of skin receptors of back extremity of a spinal preparation of a frog by 0,5%…

A: Normal resting membrane potential is about - 70 millivolt that occurs due to the operation of Sodium…

Q: What are the characteristics of a high-quality DNA extract? What do you do to determine the quality…

A: DNA extraction is a protocol used for the isolation and purification of DNA from biological samples…

Q: 9. Which one of the following histones is a component of the core particle? A. H1 B. H2A C. H2B D.…

A: In 1868, Swiss physician Friedrich Miescher extracted nucleic acids from the nucleus of white blood…

Q: what is RNA World hypothesis? What is RNA? What are the building blocks of RNA

A: The biopolymers, macromolecules, essential to all known forms of life, made up of pentose sugar,…

Q: Questions: a) what nerve will cause the palsy and why? b) what question would you ask after…

A: Given information The patient complains of having a headache and dropping of facial muscles.…

Q: Suggested Study Questions: 1. What is a karyotype? 2. Explain why staining of chromosomes is…

A: Genetics involves inheritance, characteristics, DNA, genes, proteins, and chromosomes. Everyone…

Q: Your entire genome is about 6.4 billion basepairs long. If 41% of the human genome is either…

A: Genome Genome is the heritable entity of organism which can transfer from parents to their…

Q: Please answer fast What is "variable penetrance"? Explain why autosomal dominant disease penetrance…

A: Autosomal disease The disease which is caused by the autosomal set of chromosome except the X and Y…

Q: NaCl (a salt) can disrupt protein structure. This is true because a protein containing the amino…

A: Glutamic acid is an amino acid that is used in the formation of proteins. It is converted to…

Q: ANSWER BRIEFLY: Enumerate the 4 groups of coagulation factors according to function & opposite…

A: The coagulation term means the clotting of blood. The blood normally is in a liquid state, on…

Q: Cat DNA is much more similar to dog DNA than to tortoise DNA. Why? (a) Cats and dogs are both…

A: All living things have the same genetic material (DNA), comparable genetic codes, and the same…

Q: 3. We discussed seven points regarding the attributes of life. What are the 7 points and how do they…

A: The attributes of life are Cellular organization, reproduction, growth & development, energy…

Q: ou have surveyed three (3) populations of organisms (A, B and C) using eleven (11) quadrats of fixed…

A: Population density can be defined as the number of individuals living in an area divided by the size…

Q: The _____ direct the cells' growth and

A: Answer is Nucleus It is involved in directing the cell towards growth and reproduction. It is a…

Q: Why should we expect to ﬁnd N. fosteri fossils all over the world, given that it ﬁrst evolved in…

A: Pangea is a supercontinent that was surrounded by a global ocean called Panthalassa. Fossils are…

Q: Possible answers for each: A) Both hormone and a neurotransmitter. B) Hormone. C) Neurotransmitter.…

A: Hormones only work once they "fit" a part of the body. That is, if cells within the target…

Q: Remove codons 24 to 66, inclusive AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGU

A: GENETIC CODE The genetic code is the relationship between the sequence of bases in DNA and the…

Q: Relate the process of genetic drift to genetic bottlenecks and the founder effect, using examples.

A: Evolution is the gradual shift in the inherited traits of natural populations over many generations.…

Q: If a person is severely dehydrated, explain what would happen to the plasma volume, hematocrit, and…

A: Water is very much important for living organisms including human beings. Different chemical…

Q: where would the energy this products claims to provide come from?

A: Cellular respiration is a metabolic pathway by which the consumed complex sugars molecules are…

Q: . Distinguish taxis from a tropism. 2. What is thigmotaxis? Describe what happens when the…

A: Animals and plants are two distinct types of biological beings. As a result, the pathways that they…

Q: 2. The hereunder template shall be used in enumerating the functions if the Digestive Organs: Organ…

A: Introduction: The gastrointestinal tract is a component of the human digestive system, along with…

Q: Template strand: 5' AATCATAACTCATTG 3' A. Write the CODING strand of this sequence, including the 5'…

A: Introduction : The genetic code is a collection of rules that living cells use to decode the…

Q: substance that do not dissolve well in water are a. hydrophobic b. hydrophilic c.isotonic…

A: Introduction :- An substance that is attracted to water molecules and has a propensity to dissolve…

Q: Why do vestigial structures still exist if they are no longer useful?

A: Anatomical structures in an organism that are deemed to have lost most or all of their primary…

Q: What is a wet mount technique in microscopy?

A: Microscopy is the technical field of using microscopes to view samples and objects that the naked…

Q: Describe the 4 different ways that antibodies interact with pathogens to cause immunity.

A: Introduction The immune system is the body's defense system against infection caused by external…

Q: Describe the theory of evolution, and name two ways that you can see it at work

A: It is the process of change in the heritable traits of a population over time. The organisms which…

Q: Channel gating – Carrier-mediated transport

A: Channel Gating : It is defined as the process of encoding of biological signals as a change in…

Q: Please answer fast Question #1: Use answers A-L to answer questions 1-6 below. They can be used…

A: Hydrogen bonds are a main characteristic of protein shape. By a usually usual definition, they…

Q: C. Two mutations are known in the population, one shaded in yellow and one in blue, shown on the…

A: Introduction : Any alteration to DNA is referred to as a mutation. Any genetic and heritable…

Q: Use the information in the tables below to determine the most probable number of bacteria per 100 mL…

A: Given Number of positive tube 0.1 ml = 4 0.01 ml = 1 0.001 ml = 0

Q: In cucumbers, speckled fruit color (u') is dominant to uniform fruit color (u), and large spines…

A: Given Speckled fruit colour U+ is dominant to uniform fruit colour u Large spines SS+ is dominant…

Q: Which group (Population A that stayed in the flat territory or Population B that moved to the rocky…

A: Genes are the hereditary units that control specific traits, different versions of these genes are…

Q: Explain how the following affect membrane fluidity: – Level of phospholipid tail saturation – Level…

A: The thin, living, elastic, semipermeable lipoproteinaceous membrane that is present around the cell…

Q: How do SSRI and MAOIs work? Which parts of the neural communication machinery do they target? Which…

A: SSRI and MAOI are the strong classes of anti depressants. SSRI is serotonin reuptake inhibitors MAOI…

Q: Study the sequences below. Construct a molecular cladogram from the different amino acid sequences…

A: The phylogenytic tree represent the relationship between different organisms and also gives us idea…

Q: Which of the following proteins will CERTAINLY have quaternary structure? Select one: a. autophagy…

Q: In a monohybrid cross, which of the following can result in the heterozygote displaying a different…

A: Everyone wonders why brothers and sisters look so similar to one another. This is when heredity…

Q: Rehpogs are mythical creatures. They are small and not very smart. Rehpogs live on the ground in a…

A: Introduction Inheritance patterns are of different type’s Mendelian inheritance, incomplete…

Concept explainers

Emotions

Emotions are biologically based psychological conditions caused by neurophysiological changes which are linked to different factors such as thoughts, emotions, behavioral responses, and pleasure or displeasure. These emotions are not similar to moods. The mood is an affective state. Mood depends upon several factors, such as weather, the environment, physiology, etc. Emotions can be beneficial or detrimental depending on the situation. Emotional reactions are simple. Emotional well-being is strongly affected by our well-being, and such feelings are private.

Question

The antidote to organophosphate poisoning is to administer

a drug called atropine. Atropine binds to ACh receptors on postsynaptic cells. Explain

the mechanism behind atropine’s role as an antidote to organophosphate poisoning.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Some cytoplasmic kinases, enzymes that phosphorylate substrates at the expense of ATP, bind to voltage-dependent anion channels. What might the advantage of this binding be?
Buckeyium is a medication that binds to the NMDA receptor at the orthosteric binding site (were glutamate would normally bind). Assume glycine is already bonded and magnesium isn't inhibiting the NMDAR ion channel. Buckeyium would be regarded a poison if the channel did not open as a consequence of its binding.
One of the toxins produced by Bacillus anthracis (the cause of anthrax) is known as EF, or edema factor (edema is the abnormal buildup of extracellular fluid). EF, which enters mammalian host cells, is a calmodulin- activated adenylate cyclase. Explain how this toxin causes edema.
Both rhodopsin in vision and the muscarinic acetylcholine receptor in cardiac muscle are coupled to ion channels via G proteins. Describe the similarities and differences between these two systems.
Epilepsy is a chronic disorder characterized by seizures that result whenneurons in the brain produce excessive action potentials. Channelopathiesare genetic disorders caused by mutations in ion channel genes, whichresult in ion channels that do not function normally. What kind of Na+ orCa2+channelopathies might contribute to epilepsy?
Organophosphate poisoning is a result of excess acetylcholine at different nerves and receptors in the body because acetylcholinesterase is blocked. Please provide rational to explain how the binding of organophosphate with serine in the acetylcholinesterase enzyme leads to excess accumulation of acetylcholine.
The fight-or-flight reaction prepares an animal to Pesponu Lu a threatening situation, by either fighting or running away. One aspect of this response is changes in blood flow such that the skeletal muscles and heart receive higher blood flow (vessels dilate) while digestive organs receive less (vessels constrict). A) Which signal molecule(s) is/are involved in this response, and how do they produce these changes in blood vessels? Briefly explain how this example illustrates how different cells are able to use the same ligands in different ways.
Describe the contribution of each of the following to establishing and maintaining membrane potential: (a) the Na+K+ pump, (b) passive movement of K+ across the membrane, (c) passive movement of Na+ across the membrane, and (d) the large intracellular anions.
The concentration of potassium ions inside a nerve cell membrane is higher than the concentration of sodium ions outside the mem-brane, yet the inside of the membrane (where the cation concentra-tion is higher) is negative to the outside. Explain this observation in terms of permeability properties of the membrane.
Endocrine Ligand acting on intracellular receptor should be: O Hydrophilic O Hydrophobic O Amphipathic O Macromolecule What kinds of molecules may pass through
Define Phospholipase C : IP3-DAG pathway,with diagram?
Phospholipase A2 causes the release of what fatty acid from membrane phospholipids? What chemical class of messengers is produced from this fatty acid?