A virulence factor that works by eliminating red blood cells and other cells and tissues, potentially including phagocytes. It creates a colorless area on a blood agar plate. DNase phagocytes O alpha-hemolysins beta-hemolysins gamma-hemolysins

A virulence factor that works by eliminating red blood cells and other cells and tissues, potentially including phagocytes. It creates a colorless area on a blood agar plate. DNase phagocytes O alpha-hemolysins beta-hemolysins gamma-hemolysins

Medical Terminology for Health Professions, Spiral bound Version (MindTap Course List)

8th Edition

ISBN:9781305634350

Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder

Publisher:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder

ChapterCom: Comprehensive Medical Terminology Review

Section: Chapter Questions

Problem 16SFT

See similar textbooks

Related questions

Q: Consider the following DNA mRNA sequence: 5’-ACTGATCCATGCCAGGGGTTTTCAACTAAAATGAAA-3’ a) What is the…

A: DNA carries the genetic information that is translated into mRNA and subsequently translated into…

Q: ITRATE TEST This test determines the ability of bacteria to use citrate as source of carbon and…

A: Citrate testing is used to determine the ability of the bacteria to use sodium citrate as the only…

Q: You are employed in a gene therapy laboratory to test the effectiveness of a vector for correcting…

A: The CFTR gene encodes the CFTR protein (cystic fibrosis transmembrane conductance regulator). It is…

Q: ithful is a built-in K data frame giving waiting time between eruptions and the duration of the…

A: To calculate the sample median of x, you can use the median() function in R: median_x <-…

Q: Give only typing answer with explanation and conclusion I performed an RBC count on squares 1,…

A: Finding the average number of cells per square and multiplying it by the total number of squares…

Q: Give only typing answer with explanation and conclusion What is the final concentration, as a ratio…

A: Medication is commonly administered in medical settings by diluting it in a solution, such as normal…

Q: This larger clinical trial determines whether the drug works in humans and determines the…

A: A clinical trial is a research study conducted with human participants to evaluate the safety,…

Q: Saying Flowered flavors instead of flowered favors is an example of what type of speech error? 1.…

A: A speech error is a deviation from the intended form of an utterance. There are different types of…

Q: what will be the trend in the graph of a an experimental result of potato slides whose % initial…

A: The issue is weighing potato slides over time while doing an experiment. The potato slides have…

Q: Pick a specific microbiome (i.e. skin, mouth, gut, reproductive) and discuss interesting points and…

A: Q1) The gut microbiome is a complex ecosystem composed of bacteria, viruses, fungi, and other…

Q: In an experiment conducted on photosynthesis-CO2 update and photosynthesis-Determining rate in white…

A: In photosynthesis, the main gas produced as a product is oxygen (O2). During the process of…

Q: Indole Production from the Amino Acid Tryptophan and Catabolite Repression (p. 291) What is…

A: Note:- sorry since you have posted multiple questions with multiple subparts, we will be solving the…

Q: Diabetes insipidus:* a. Hypernatremia due to decreased water intake b. Hypernatremia due to excess…

A: Diabetes insipidus is a disorder that occurs when there are low levels of ADH (Antidiuretic hormone)…

Q: In a pedigree, a female is represented with a square while a male is represented with a circle. True…

A: The occurrence and emergence of a certain gene or organism, as well as its ancestors, from one…

Q: Considering the symptoms and current explanations for why someone might develop a Mental/Behavioral…

A: Schizophrenia is a serious mental health disorder that affects how a person thinks, feels, and…

Q: Young Saguaro Cacti Under Another Plant Not Under Another Plant Total At your study site in the…

A: In this scenario, we have observed data regarding the presence of young saguaro cacti under other…

Q: Which division of the autonomic nervous system would likely be activated if a student learned that…

A: When the student realizes they have forgotten about an exam that is about to begin in a few minutes,…

Q: Write a short story about your life as a chemical message/protein that was created by the nucleus.…

A: I, a chemical message in the form of a protein, was once created in the center of a bustling cell. I…

Q: Which reaction below is an oxidation reaction? I. 1,3-bisphosphoglycerate (BPG)→…

A: Oxidation is referred to as gain of oxygen or loss of Hydrogen or loss of electrons. It is the…

Q: 83. Due to their low density, females of a species of turtles are having difficulty finding mates.…

A: Mate availability is a critical factor in reproductive success. When individuals fail to find mates,…

Q: Which of the following scenarios would lead to severe hypoglycemia? Choice 1 of 6: A non-diabetic…

A: Hypoglycemia refers to a condition characterized by low blood glucose levels, commonly known as low…

Q: How would you draw this mind map

A: The mind map illustrates the factors that influence the physical activity and sport participation of…

Q: long polysaccharide chain

A: Carbohydrates:These are a group of organic compounds which serves as a primary source of energy for…

Q: Give only typing answer with explanation and conclusion Semi-discontinuous DNA replication, in the…

A: The procedure of copying a DNA molecule to create duplicate identical daughter strands is known as…

Q: 1.Where can we find the Circle of Willis in 10 mm pig embryo? What are the branches

A: Disclaimer: Since you have asked multiple questions, we will solve the first question for you. If…

Q: DNA sequence A: 5' - 3' TAACTTAAGGCCAATCGAAATCTTAAGGCGGTATACGCGTTAACCTTAAGG 3' DNA sequence B: 5'…

A: Restriction enzymes are restriction endonucleases that have specific restriction sites and…

Q: 3. Compare and contrast the contributions of the following two biologists. What would be the effect…

A: Rosalind Franklin was an English chemist and crystallographer. She played a crucial role in the…

Q: Respiratory Rates Typical Rate Observed Rate Rate after hypoventilation Rate after hyperventilation…

A: Breathing is the process by which air enters and exits the lungs. This is accomplished through a…

Q: SDS-PAGE w/o B-mercaptoethanol LANE 1 D LANE 2 C SDS-PAGE w/ B-mercaptoethanol LANE 1 LANE 2 B C D

A: Electrophoresis is defined as the migration of charged particles under the influence of an electric…

Q: A scientist observing a cell during gene expression would be able to easily distinguish it as a…

A: “Since you have posted multiple questions, we will provide the solution only to the first question…

Q: At which point on the phylogenetic tree did dominant sporophyte generation evolve

A: A dominating sporophyte generation characterizes vascular plants, which also include ferns,…

Q: 8. In general, when the nonbicarbonate buffer concentration is normal, an acute PaCO2 rise to a…

A: The relationship between non-bicarbonate buffer concentration and the changes in [HCO3-]…

Q: Interpret the given scatter plot

A: The relationship between two numerical variables is represented using a scatter plot, which is a…

Q: 2. You are an epidemiology consultant to a large factory. You conduct a study of the occurrence of a…

A: As an epidemiological consultant for a big manufacturing company. We investigate the occurrence of a…

Q: 5. Change this amino acid from its nonionic form (pictured) to its ionic or Zwitterionic form. You…

A: Amino acids are the fundamental building blocks of proteins, which are essential for numerous…

Q: You are studying a population of giraffes. In this population, one gene (G) controls spot color in…

A: Incomplete dominance is a genetic inheritance pattern in which the heterozygous phenotype is an…

Q: Complete the sentences You cross two mice with wildtype (long) tails and collect a male offspring…

A: Imprinted gene is whom gene is silenced and gene from other parent us expressed. In this case from…

Q: What is the advantage of having Complexes I, III, and IV associated with one another in the form of…

A: A chain of compounds known as the electron transport chain uses the electrons from an electron…

Q: The Biofuels industry is interested in engineering bacteria so that they may produce fuels such as…

A: A protein known as σS (sigma S) or RpoS (RNA polymerase sigma factor S) is encoded by the rpoS gene.…

Q: A. One of you per group will be on his/her normal fluid intake for 24 hours prior to ingesting the…

A: Let's look at how each of the conditions will affect urine volume, urine flow, and urine specific…

Q: Identify the following amino acid at pH = 7 (aqueous form): (COO-)–CH(NH3+)–CH2–(COO-) aspartic…

A: These questions are about amino acids which are the building blocks of proteins. Various amino acids…

Q: his is a visible spectra between 390-590 nm obtained during the protein separation process of…

A: Haemoglobin contains a heme group that gives it its red color. The absorption spectrum of…

Q: Describe stepwise the pre-mRNA processing, how small noncoding RNAs regulate gene expression and…

A: A gene is made up of DNA. It is eventually transcribed into mRNA that helps in the process of…

Q: Each of the following describes a distinctive step in a genomic technology or experimental design.…

A: Answer.) :- Genomic technology and experimental design have revolutionized our understanding of…

Q: A dominant phenotype you are studying is present in 8.25% of people in a population you are…

A: The principal, Hardy-Weinberg equilibrium states that the genetic variation in a population will…

Q: Similarities between bronfenbrener ecological model and medicine wheel 3 in brief

A: Ecological theory is used to study the psychological development of humans. It tells about the…

Q: Give typing answer with explanation and conclusion to all parts Which of the following factors…

A: The ability of bacteria or other microorganisms to withstand the effects of antibiotics that were…

Q: scientist is interested in the amplification of a specific DNA fragment in a large plasmid of about…

A: The specific DNA sequence can be amplified by using primers in the polymerase chain reaction or PCR.…

Q: Give typing answer with explanation and conclusion A contractile vacuole is an organelle that…

A: The contractile vacuole is a vital organelle found in many freshwater protozoan cells, responsible…

Q: Artifactual hyperkalemia: a.Sample hemolysis b.Sample hemolysis, thrombocytosis c.Sample…

A: Artifactual hyperkalemia:Hyperkalemia is a condition where the potassium concentration in the serum…

Question

A virulence factor that works by eliminating red blood cells and other cells and tissues, potentially including
phagocytes. It creates a colorless area on a blood agar plate.
DNase
phagocytes
O alpha-hemolysins
beta-hemolysins
gamma-hemolysins

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1: Introduction

VIEW

Step 2: About the question

VIEW

Solution

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

All patients should be considered infectious. True or false
Clot and scab formation occur as part of this process: Group of answer choices cytolysis hematopoiesis phagocytosis inflammation
Pin-point hemorrhage refers to which of the following? Ecchymosis Petechia Hematoma Puncture wound
What is the process in which antibodies attach to antigens, causing the formation of masses of linked cells? agglutination coagulation hemolysis precipitation
Bacteria can avoid being swallowed by phagocytic white blood cells producing which virulence factor? Antibiotics Capsules Adhesins Endotoxin
This plate shows: Beta hemolysis Alpha Hemolysis Delta hemolysis Gamma hemolysis
The presence of Aspergillus flavus in an immunocompromised patient is cause for great concern for the medical team. What term is used for an infection caused by a pathogen which affects patients who are already weakened, but not healthy persons ?
Your client comes to you with a rash covering his lower legs and arms. The area is inflamed and erythematous and weeping slightly. He tells you he was clearing out some brush behind his house. You diagnose poison ivy. Your initial response will be a SOAP Note to
Your patient has gout. Can you explain the cause/patho/treatment of this disease?
In two complete sentences tell me the definition of a reticulocyte and why would we see an increase of them in the circulating blood BIUA - A - I E E 3 X x, = E Paragraph 12pt fr
The doctor order to administer a strong antibacterial drug that needs to be diluted in 150 mL of D5W and delivered in 30 minutes. Which of the following administration method are you going to used? Don't copy from chegg 1. Continuous infusions 2. Intermittent infusions 3. Direct intravenous push 4. Intravenous push
A 3-year-old girl with a fever is sent to the hospital and is found to have a Pseudomonas sp. infection. Her platelet count was 60 x109/L, her haemoglobin value was 74 g/L, her white blood cell count was 1x109/L, and blast cells were seen on a peripheral blood film. Ninety percent of the cells in the bone marrow were blasts, according to a smear. Upon immunophenotyping these blasts using flow cytometry, positive phenotypes for CD10, CD19, (partial)TdT, and CD34 were observed.