A pre-mrna containing just three exons will also contain.... introns? 3 2 1 0

Q: DNA MANNMANN B mRNA Transcription Transport to cytoplasm for protein synthesis (translation) Mature…

A: Introduction :- Protein synthesis is the process of creating proteins from amino acids inside live…

Q: A mutation occurred in the DNA sequence during replication. Which of the following, A-D, describes…

A: A mutation occurs when the nucleotide sequence of an organism, virus, or extra - chromosomal DNA is…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: The following image represents a gene model. Which part is (are) exon(s)? type your answer... Which…

A: Eukaryotic protein-coding genes are segments of DNA in eukaryotic organisms that contain…

Q: Based on your know | (hir sequence.

A: In many eukaryotic (and other prokaryotic) genes, the original RNA extracted from a genetic DNA…

Q: What do you mean by post translational folding?

A: Protein folding takes place in the endoplasmic reticulum and proteins folding an important process…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: The following double stranded segment of DNA is part of a protein coding gene. The segments in…

A:

Q: explain as you would to a 12th grader why it is necessary for introns to be spliced from pre-mRNAs.

A: Transcription is the process in which mRNA is synthesized from the DNA by the action of polymerase…

Q: a) Two of the following three mRNA sequences code for the same protein.  Delete the sequence which…

A: Translation is defined as the process where the nucleotide sequence in the mRNA is translated to…

Q: 1) Describe the dna transcription-mRNA with all the step.

A: The discovery of DNA as genetic material is one of the most significant discoveries in molecular…

Q: A gene affecting the behavioral outlook of individuals was discovered in several humans who can…

A: Transcription is the process of the formation of RNA from DNA. Through transcription, the…

Q: 5. You're working in Marshall Nirenberg's lab, trying to decipher the genetic code. You use several…

A: Introduction Marshall Nirenberg discovered a way to determine the sequence of the letters in each…

Q: I would like to know how you find the non-transcribed DNA sequence when you are given a 5 prime to 3…

A: The central dogma of molecular biology explains the flow of genetic information through the…

Q: Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the…

A: Introduction The process of duplicating a DNA molecule is known as DNA replication. When a cell…

Q: If a DNA sequence is 5’ CGCTAGACT 3’, the complementary DNA sequence will be? If a DNA sequence is…

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: Introns are intervening sequences; what are exons?

A: A gene is an essential unit of heredity and a sequence of nucleotides in DNA or RNA that encodes the…

Q: Which of the following MRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…

A: The mRNA is a single-stranded molecule of RNA that corresponds to the genetic sequence of a gene.…

Q: ow many amino acids will the mRNA sequence "AUG GAC CUG UCG A" produce? (LS1-1) *

A: Amino acids production.

Q: The Human Genome Project showed that human DNA is not considerably bigger than much simpler…

A: A genome is all the DNA in an organism, including its genes. Genes carry information for making all…

Q: Why do you think the DNA must be unzipped before it is transcribed into messenger RNA?

A: Gene expression is a complex biological mechanism that involves the production of mRNA and proteins…

Q: Eukaryotic mRNAS have a 5' end while prokaryotic mRNAs do not. O IV.

A: Ans- D Explanation- Eukaryoticic and prokaryotic mRNA are two different mRNAs. Prokaryotic mRNA is…

Q: if the following DNA sequence were transcribed, which of the following describes the output of this…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Discuss why you think the ribosomes need to contain so many proteins and rRNA molecules. Does it…

A: Ribosomes are present in both plant and animal cells. they are present in both prokaryotic and…

Q: The following DNA sequence corresponds to the two extreme ends of a gene's coding region: 5'…

A: Introduction = The genetic code consists of tripletsThe group of three nucleotides that together…

Q: A piece of mRNA is moving along the ribosome.  Which amino acid would bind if the mRNA read....…

A: The process of protein synthesis is called translation. It occurs on ribosomes bound to mRNA in the…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?

A: A genetic mutation known as a deletion occurs when one or more nucleotides are lost from a DNA…

Q: Here is the complete mRNA sequence from a bacterial cell: 5'…

A: To determine how many tRNAs will bind to the ribosome to make the protein, we need to consider a few…

Q: diagram shows a pre essing. present that splicing bind here. What components of this transcript will…

A: Introduction Messenger RNA (mRNA) is a cellular component that transports instructions from DNA in…

Q: 21. The processing events that must occur on the MRNA after it is transcribed, but before it is…

A: In eukaryotes, transcription and translation take place in different cellular compartments:…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: a. What polypeptide is coded for by the mRNA sequence: 5'-GCU-GAA-GUC-GAG-GUG-UGG-3'? N-terminus -…

A: A sequence of three consecutive nucleotides in messenger RNA (mRNA) coding for amino acids is…

Q: Use the DNA sequence above, list all possible splicing products

A: Splicing, is a form of RNA processing in which a pre- mRNA transcript is transformed into a mRNA.…

Q: You are studying a eukaryotic gene in which translation normally begins at the second AUG in the…

A: Self-explanatoryPlease give me a helpful rating if you are satisfied with my answer

Q: What are the nucleotides of the mRNA from gene Z? (see the attached picture)

A: Transcription is the process of synthesis of mRNA from DNA. The DNA strand which acts as the…

Q: Explain why mature mRNA transcripts is a different size that pre-mRNA transcripts.

A: When an RNA transcript is first made in a eukaryotic cell, it is considered a pre-mRNA and must be…

Q: The diagram shows a pre-MRNA before splicing and processing. In this cell type, a protein is present…

A: RNA-Splicing:  In molecular biology, RNA splicing is the process by which a newly synthesised…

Q: Below is an mRNA molecule in its wild type form. 5’ CCGUACAUGGUGAAAAGUCAAUGACCAAA 3’   An…

A:

Q: How many amino acids are coded for by the following mRNA: 5…

A: From the DNA, genetic information is transcribed in the form of codons. These codons reside in the…

Q: Discuss how the bigger mRNA leads to creation of a smaller polypeptide?

A: For protein synthesis, the first step in transcription. In transcription, the information from DNA…