7. The following scatter plot shows the weights and lengths of some dinosaurs. Dinosaur Sizes Weight (tons) 2822222° 70 20 10 0 20 40 60 80 100 Length (feet) ➜X Which statement accurately describes the information in the scatter plot? A. The information shows a positive correlation. The weight of a dinosaur tends to increase according to its length. B. The information shows a negative correlation. The weight of a dinosaur tends to decrease according to its length. C. The information shows no correlation. The weight and length vary according to the type of dinosaur D. The information shows no correlation. The relationship between the weight and length of a dinosaur is uncertain.

7. The following scatter plot shows the weights and lengths of some dinosaurs. Dinosaur Sizes Weight (tons) 2822222° 70 20 10 0 20 40 60 80 100 Length (feet) ➜X Which statement accurately describes the information in the scatter plot? A. The information shows a positive correlation. The weight of a dinosaur tends to increase according to its length. B. The information shows a negative correlation. The weight of a dinosaur tends to decrease according to its length. C. The information shows no correlation. The weight and length vary according to the type of dinosaur D. The information shows no correlation. The relationship between the weight and length of a dinosaur is uncertain.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter24: Systematics And Phylogenetics: Revealing The Tree Of Life

Section: Chapter Questions

Problem 9TYK: Which of the following pairs of structures are homoplastic? a. the wing skeleton of a bird and the...

See similar textbooks

Similar questions

Among a population of tadpoles, the correlation coefficient for size atmetamorphosis and time required for metamorphosis is −0.74. On thebasis of this correlation, what conclusions can you draw about therelative sizes of tadpoles that metamorphose quickly and those thatmetamorphose more slowly?
Estimate the surface area of an adult human's head. Multipie Choice 05 m2 0.1 m2 10 m2 0.01 m
2. Calibri B ctions: Read each question below carefully, determine correct equation to use, and calculate for the variable ng asked for in the question. Show your work. 12 + b A population of 20 velociraptors has 4 babies in one breeding season. However, 2 of the older velociraptors die off due to old age. What is the growth rate of this population of velociraptors? Type answer here A population of 100 mice has a growth rate of 0.2. In an exponential growth environment, what is th Type answer here What if the population of mice had a carrying capa Tuna anciar hara
In a population of chickens, calcium and growth hormone excreted in chicken dung exhibit a genetic correlation of -0.7. If chickens with higher growth hormone levels are selected in this population, what will be the effect on calcium levels? A. calcium levels will go up B. There is no way to determine the effect on calcium levels with the information given. C. calcium levels will remain the same D. calcium levels will go down
1. Paleontologists have constructed the following diagram to outline the evolution of the horse. Identify and explain two possible types of evidence that these scientists might have used in constructing this model. 10000 yeas g 14 to 7 million yeas g bout 20 million yeas g about 30 milion ye g about 60 mallion years ag
EVOLUTION ASSESSMENT - FINCHES Galápagos Ground Finches Between 1973 and 1978, the population of ground finches (a type of small bird) on the Galápagos Islands decreased. Scientists made observations of the population throughout that time period. They recorded and graphed differences in the distribution of traits over time. The two sets of graphs below come from the data they collected. Beak Length for Ground Finches Observed in the Wet Seasons of 1973 and 1978 Wet 1973: all finches # of finches 30 # of finches 25 20 15 10 5 0 30 25 20 15 10 5 12-01 0 $4.9 80-84 30.0- 11.5-11.9 Beak Length (mm) Source: inquiryHub 35.0-39.9 40.0-44.9 12.5-12.9 13.0-13.4 13.5-13.9 14.0- Wing Length for Ground Finches Observed in the Wet Seasons of 1973 and 1978 Wet 1973: all finches 65.0 Wing Length (mm) Source: inquiryHub 70.0-74.9 # of finches 75.0- 30 25 # of finches 20 10 5 0 30 25 20 15 O 10 5 0 Wet 1978: all finches 7.0-74 7.5-7.9 80-8.4 85-80 9.0-94 9.5-9.9 10.0-1 30.0-34.9 10.5-10.9 11.0-11.4…
Make a graph in Excel using the data ( the image ) This data represents results from a fictional study comparing bee body weight to insecticide exposure. a. Tittleb. The graph can be any style or format but must display a relationship between the independent (x axis) and dependent (y axis) variables.c. Both axis of the graph must be correctly labeled, including correct units, andrepresent the independent and dependent variables.d. The graph must contain a trendline with a trendline equation and R2 value
4. Here are data from a 2006 Science article by Erickson et al. describing nonavian dinosaur life tables. B 1000 100 - 10 - Human Elephant Albertosaur Osprey Seal Thrush Buffalo Alligator Daspletosaurus Tyrannosaurus Gorgosaurus Albertosaurus 20 40 60 80 100 0 20 40 60 80 100 % of Lifespan % of Lifespan From: Erickson Gregory M., Currie Philip J., Inouye Brian D., & Winn Alice A. (2006). Tyrannosaur Life Tables: An Example of Nonavian Dinosaur Population Biology. Science, 313(5784), 213-217. a. Based on the number of surviving individuals and the survival rate of individuals in each species, what type of survivorship curve is the best fit for the four species of dinosaur in panel B, and why? b. How does this survivorship curve compare to the curves for human, osprey and alligator shown in panel A? Survivors
Weighing the calves every month should be done every time at the same moment of the day. Let's say in the morning after coffee break. In that situation, you can expect all animals to have sufficiently eaten after morning feeding. v Why is this important? v When you are the owner of the above-mentioned calf would you be satisfied? V Motivate your answer: In case you measure a girth of 121 cm, how will you read the table? (121 is in between 118 and 125 cm representing 145 kg. and 170 kg. 7 cm difference represent 25 kg => every cm represents 3,5 kg weight difference.) The weight of a calf having a girth of 121 cm is Kg. .........
Seven sauropod dinosaurs of the same species (Apatosaurus ajax) from the same population in Montana have neck lengths of 7.3, 8.0, 7.7, 7.8, 8.3, 8.4, 7.9, and 8.0 meters. A different population of the same species from Utah has neck lengths of 8.0, 8.3, 8.3, 8.8, 8.1, 9.0, and 9.3 meters. a) Calculate the mean, median and mode for each population. b) If wanted to compare data from the two populations, what type of graph would you choose and why?
Review the diagram and select ALL 5 derived characteristics shown for birds. turtles, lizards, snakes crocodiles dinosaurs birds mammals avian endothermy asymmetrical feathers bipedalism parental care endothermy keratinized skin mammary glands hair amniote egg mammary glands O b hair amniotic egg bipedalism O e keratinized skin O f parental care avian endothermy 000 00 00
when molêct are similar the DNA strands are in two org how species are related to one another arise. activity below and learn more about it. Activity 2.3: How Related Are We? Cytochrome C in different species. Look for that part in the DNA where the human, chimpanzee, and mouse vary, Encircle that part with a Then answer the guide questions that follow. Note: You may reproduce this sequence genetic of the module to repeat the process of tracking similarities in the sequence. WHuman ATGGGTGATGITGAGAAAGGCAAGAAGATTITTATTATGAAGTGTTCCCAGTGCCACACC GTTGAAAAGGGAGGCAAGCACAAGACTGGGCCAAATCTCCATGGTCTCTITGGGCGGAAG ACAGGTCAGGCCCCTGGATACTCTTACACAGCCGCCAATAAGAACAAAGGCATCATCTGG GGAGAGGATACACTGATGGAGTATTTGGAGAATCCCAAGAAGTACATCCCTGGAACAAAA ATGATCTITGTCGGCATTAAGAAGAAGGAAGAAAGGGCAGACTAATAGCTTATCTCAAA AAAGCTACTAATGAGTAA https://www.pbs.org/wgbh/nova/ article /dna-human-evolution/ https://www.ncbi.nlm.nih.gov/pme/articles/PMC5704239/ #Mouse ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTGTTCAGAAGTGTGCCCAGTGCCACACT…