7. Differential (Alternative) RNA processing A. Cu vs Cô (IgM vs IgD) B. Membranous Ig vs Secretory Ig 1

Q: 1. What is the effect of RNAI on gene expression? A. Knock out B. Knock down C. Knock up D. Knock in

A: RNAi means RNA interference which is a biological process in which miRNA / siRNA neutralizes the…

Q: 8. Another unique feature of coronaviruses is usage of a -1 ribosomal frameshift. Explain this…

A: Defination- Ribosomal frameshifting is a biological phenomenon that occurs during translation that…

Q: 24. TRUE or FALSE: A microRNA (in red) binds to its mRNA target (black) as shown below:…

A: False  The target will be cleaved.

Q: 3. please answer this asap

A: The goal during this scenario is to match distinct cis-regulatory elements with the relevant deleted…

Q: Which of the following statements about epigenetics is correct? 1. Twins have identical epigenetic…

A: Epigenetics is the study of heritable changes in gene expression that do not involve changes to the…

Q: The RNA-induced silencing complex (RISC) _____ i. Binds to and unwinds ds siRNA/miRNA to produce…

A: The answet is b. II only RNA-induced silencing complex(RISC) is a multiprotein complex which…

Q: + + T | + + 1 = + T +||| + 2 +11 + 1 + + 1 + + + 1 + + + + 3 4 5 + + I 9 9 5 U 4 m N 1 + - - + + + +…

A: Given here are point mutattions and the correct order is as follows.

Q: 47. hTERT is repressed in these cells: A. Germ cells B. Tumor cells C. Somatic cells D. A and B

A: hTERT is represses in the cells.

Q: Match the terms with the type of transposon B. IS A. retrotranspson abundant in humans A L1 8 DNA…

A: A DNA (deoxyribonucleic acid)  that is capable of transposition, such segments are mostly found in…

Q: 1. Compare the consequences of a mutation that occurs in the Ras proto-oncogene and a mutation that…

A: Mutations in key genes can have profound effects on cellular processes, particularly when they…

Q: 13. Choose/mark the correct word to complete the statement. Consider the regulation of CAMP and the…

A: Operon is the segment of DNA which contains regulatory gene, promoter gene, operator gene and…

Q: 3). Consider the four mutations (i-iv) described below: i. One of the mutations causing cystic…

A: A mutation is a permanent change in the DNA sequence of an organism's genome. Mutations can occur…

Q: Which of the following statements about epigenetics is correct?         1. Epigenetic drugs could be…

A: Epigenetics are the changes in gene expression.

Q: A mutation in one of the IR sequences of Tn5 would inhibit the transposition of the ISS0 sequence…

A: Introduction Tn5 is a transposon of composite nature that codes for transposase protein responsible…

Q: functional insulin required the association of two polypeptides known as the A and B chains…

A: Pre transcription control involves in DNA methylation.  Transcriptional control involves in…

Q: Which sigma factor is activated in the stationary phase? O A. RpoN O B. RpoE O C. RpoH O D. Rpos O…

A:

Q: A specific micro RNA is capable of destroying/degrade m-RNA after synthesis A. TRUE  B False

A: Introduction : The molecule RNA is crucial in translating the genetic code found in a cell's DNA…

Q: The organization and expression of lymphocyte receptor genes

A: Lymphocytes are part of white blood cells also called as WBC , which plays an major role in immune…

Q: Describe an example of a pathological condition that results in mutants genes that control…

A: The table format allows for a concise presentation of the inducer, its pathway components,…

Q: 6. _____ is a DNA sequence. 1.Coactivator   2.Corepressor   3.Enhancer   4. Inducer…

A: Deoxyribonucleic acid or DNA is a genetic material present in each and every individual that…

Q: a. b. What constitutes the protein-coding region of a mature mRNA molecule?

A: INTRODUCTION  The process of copying a segment of DNA into mRNA known as transcription. In the DNA…

Q: 21. Which of the following is NOT a function/ property of the Signal Recognition Particle  a.…

A: The Signal Recognition Particle (SRP) is a ribonucleoprotein complex and plays important roles in…

Q: The transcription initiation factor “recruited” together with RNA-Pol II in the formation of…

A: Transcription is a process of making an RNA copy from a gene’s DNA sequence. This is known as…

Q: 17. Which of the following can turn a repressible operon on? A. An increase in concentration of the…

A: An operon is a functioning unit of genomic DNA in prokaryotes that consists of a cluster of genes…

Q: QUESTION 3 DNA methylation O a. You cannot methylate DNA O b. Enhances O c. Represses O d. Represses…

A:

Q: The RNA-induced silencing complex (RISC) I. binds to and unwinds ds siRNA/MIRNA to produce ss…

A:

Q: Which of the following defects in RAS would be tumorigenic? multiple answers    A. Deletion of…

A: Ras is a nucleotide binding protein that is responsible for cell division, growth and…

Q: . heterochromatic regions decondense for gene expression a. pre-transcriptional control b.…

A: Heterochromatin regions are condensed regions of the chromatin that are transcriptionally switched…

Q: 5. Scientists recently described a unique family of chemotactile receptors (CRs) that allows for…

A: Octopuses are highly intelligent and resourceful animals that possess a complex nervous system and…

Q: When a gene is normally not transcribed   a. it cannot be up- or downregulated   b. it can be…

A: Given: When a gene is normally not transcribed.

Q: he RNA-induced silencing complex takes dsRNA and   a. Forms ssRNA that will target mRNA   b.…

A: The RNA-induced silencing complex (RISC) is a critical component of the RNA interference (RNAi)…

Q: In a suppressor interaction, produce(s) a protein complex that is 1 mutation, active . 1 mutation,…

A: Any change or alteration to the composition of DNA other than recombination of the DNA is called a…

Q: A transgene is successfully integrated into the genome of an animal zygote. The transgene is under…

A: The foreign DNA (gene) is incorporated into a host organism by the process of recombinant DNA…

Q: The nr2f5 gene is transcribed into mRNA in both neurons and glia. The microRNA miR-5xb has partial…

A: Introduction  The expression of genes is highly regulated in both prokaryotes as well as in…

Q: tight packing of previously less condensed chromatin   identify which describes the statement…

A: Post translational modifications in histone proteins can change the shape of chromatin, which can…

Q: female calico cat has patches of black and white due to random x-chromosome inactivation a.…

A: * Calico cats are always femal and they will displays red and black based colors  depends on which…

Q: Which of the following conditions will result to deactivation of a gene? a. histone methylation b.…

A: In this question we have to describe about regulation of genes . See full answer in step 2.

Q: Genes in a bacteriophage that are expressed after expression of genes that initiate the lytic cycle…

A: There are three classes of genes in the phage genome that regulate whether the lytic or lysogenic…

Q: Translate the following mRNA transcript   5’CGCCGAUGCGCGAUAUGUGGUAA’3   A. RRCAICG   B. ADARYVV   C.…

A: mRNA, or messenger RNA is a type of RNA (ribonucleic acid) that plays a crucial role in the process…

Q: 4 Draw a map showing the order of the genes that enter the F- cell for the figure on the right. Hfr

A: The plasmid mapping is given in the figure. The F- is the recipient cell.

Q: fill in the blank for the following:  a. HPAT2,3, and 5 when prevented from being transcribed…

A: Nucleic acids are biological molecules "Proteins required for the construction and function of all…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.