Which of the following defects in RAS would be tumorigenic? multiple answers A. Deletion of nucleotide binding domain B. Inactivation of Guanine Exchange Factor (GEF) C. Mutation at amino acid 61 that prevents hydrolysis of bound GTP D. Inactivation of GTPase Protein (GAPS) E. Mutation that prevents binding of GTP
Q: The following is made up of two or more alike types of cells grouped together. O a. Atom O b.…
A: The question is to find, which one given in the options is made up of two or more alike type of…
Q: Assume that two pigments, red and bluc, mix to give the normal purple color of petunia petals.…
A: Epistasis is the phenomenon in which one gene expression is modified by the mutation in one or…
Q: The ability of water molecules to form hydrogen bonds with other water molecules is critical to: O…
A: Hydrogen bonds form when hydrogen atoms covalently bonded to nitrogen (N), oxygen (O), or fluorine…
Q: CHROMOSOME DNA GENE
A: The similarity and difference between: Chromosome and gene. Gene and DNA Chromosome and DNA. in…
Q: The Mayor of the City is best compared to which part of the cell?* Nuclear Envelope…
A: Cell is the basic structural and functional unit of life. Organelles present in the cell are like…
Q: f. What is the temperature inside the laboratory refrigerator? 8- What is the temperature inside the…
A: We are allowed to do one question or up to three subpart of a question. Please repost the undone…
Q: 1. After mitotic cell division, each daughter cell must receive 3. Normal members of the some…
A: DNA is the deoxyribonucleic acid. It sis the genetic material of the cell and carries the…
Q: 6. Indicate the appropriate SI unit and instrument to use to measure the following: a. Mass of a…
A: Introduction A living organism possesses vital energy to sustain life. The living organism can…
Q: What are Differentiated cells ?
A: All living beings are composed of one or more cells.
Q: Explain with 7 sentences how Koch's postulates cemented the germ theory of disease.
A: Introduction The generally accepted scientific theory for many diseases is the germ theory of…
Q: Metro Water District is comparable to this organelle for its storage and supply of water to the…
A: An organelle is a subcellular structure that, like an organ, has one or more specific jobs to do in…
Q: 16. Divide these animal tracks using a dichotomous key: Beaver Black Bear for example: Has 5 Toes /1…
A: Dichotomous key is a technique used by the scientist in order to classify an organism like plant /…
Q: The order states to administer 0.24 g of a medication that is available from the pharmacy as 80 mg…
A: Solution: Answer is- 22.5 mL
Q: The moray eel and cleaner wrasse story at the beginning of the chapter is an example of which type…
A: The study of the relationships between living species and their physical surroundings to uncover key…
Q: There is another characteristic of frogs that made experts believe that they would survive the new…
A: Introduction : Frogs are cold-blooded animals i.e poikilotherms. Their body temperature varies…
Q: Sudupe
A: Chromosomes are the condensed form of nucleic acid. The chromosomes are formed during the cell…
Q: Why do we need endonucleases to cut DNA if we are 60-70% water that was shown to hydrolyze phosphate…
A: A bacterial protein termed restriction enzyme, also known as restriction endonuclease, cleaves DNA…
Q: A child weighing 70 pounds is prescribed quinine sulfate; the normal adult dose is 325 mg TID. Use…
A: Clark's rule equation is a method used to calculate the dosage of medicine that can be given to a…
Q: Describes a process that can be optimized with the incorporation of a membrane bioreactor
A: A membrane bioreactor is a technology described as a combined treatment process where the selective…
Q: 1)Determine the sex of the individual/patient based on your karyotyping results attached below.…
A: Introduction A karyotype is a eukaryotic cell's nucleus' number and arrangement of all of its…
Q: The following is made up of two or more different types of elements grouped together as a unit: O a.…
A: Elements An element is a simplest unit which cannot be divided further by physical means.
Q: Worksheet Check the box next to the tree that is that is most parsimonious Instructions: Consider…
A: The phylogenetic tree may be characterized as a two-dimensional graph depicting one organism's…
Q: Describe the difference between the artificial selection of organisms and genetically modifying…
A: Genetic engineering is a process in which genetic material is manipulated by man invitro for the…
Q: What is programmed cell death ?
A: Cells are formed from preexisting cells. The older and worn-out cells die with time.
Q: How do we know that malignant tumors arise from a singlecell that contains mutations?
A: Introduction A tumor is nothing but uncontrolled cell division, which can lead to the formation of…
Q: Prior to publication in a scientific journal, an article must undergo the process of peer review. In…
A: Introduction: The abbreviation IMRAD encapsulates the fundamental organisation of a scientific…
Q: Viruses display all the characteristics of living organism but many scientists do not consider…
A: A virus is an infectious microorganism made up of a protein-coated segment of nucleic acid (either…
Q: Evidence supports that feathers evolved before flight, and were later co-opted for flight. This is…
A: Any net directional change or cumulative change in the characteristics of organisms or populations…
Q: Under what conditions when the Renkin-Crone equation can be applied? Why? Give an example situation…
A: Renkin-crone Equation : The renkin- crone equation shows that the transport from the blood in…
Q: A healthy couple had their first child affected by cystic fibrosis. Their next three sons were not…
A: The alleles are the alternative forms of a gene that are located on the same locus of a homozygous…
Q: researcher would like to evaluate the claim that a new drug, "Acne Buster" can help individuals…
A: There are mainly four types of research methods. They are observational, correlational, experimental…
Q: describe implantation of a blastocyte using simple label diagrams.
A: Introduction : In males, the parent organism creates a haploid sex gamete known as sperm, and in…
Q: therefore, can treat many diseases of the blood. In the past, extracting bone marrow from a donor…
A: It is a technology which involves the passing of person blood via an an apparatus which…
Q: Hemoglobin has a molecular weight 16,000 Daltons. convert hemoglobin concentration from 13 g/dL to…
A: Given , Hemoglobin molecular weight= 16000 Dalton Convert Hb concentration from 13 g/dL to mM/L
Q: Question 13 Which of these are problematic for endangered species? Founder Effect habitat loss…
A: Endangered species The species that are very less in number and are going to extinct in near…
Q: An endocrinologist is supervised by a patient, 40 years old, who has an inferiority of the function…
A: Introduction : The Adrenal glands present on the kidneys, secrete various hormones which control…
Q: Please write introduction paragraph on the topic about about human germline gene editing using…
A: Successful somatic and germline genome editing is becoming possible thanks to CRISPR/Cas9 and other…
Q: F2 plants segregate colored : colorless. If a colored plant is picked at random and selfed, what is…
A: Introduction :- The term "progeny" describes the offspring of living things like plants and animals.…
Q: Fossil fuels are a sink for carbon located in the a. hydrosphere. b. lithosphere.. c.…
A: Fossil fuels They are the prehistoric dead plant and animal which is made up of hydrogen and…
Q: Discuss the relationship between viruses and endocytosis. Compare bacteriophage AND animal viruses…
A: Endocytosis is the engulfment of any molecule inside the cell membrane of the host. Receptor…
Q: What are Human-Made Chemicals and Pollutants ?
A: A material that is present in concentrations that could be harmful to creatures (including people,…
Q: In 1887 a strange nerve disease attacked the people in the Dutch East Indies. The disease was…
A: * Dr. Eijkman conducted experiment on the chicken to find out the reason behind the nerve disease…
Q: homologous
A: Chromosomes are found in the nucleus of living cell . Which are hereditary materials for living…
Q: How does covid 19 interact with nonspecific immune responce?
A: The virus that causes COVID-19 is found in the nasal cavity and mouth and deep inside the lungs.…
Q: How bacteriophage lambda carrying your gene of interest can introduced into the host cells.
A: Introduction : The viruses that infect and reproduce within bacteria are called bacteriophages.…
Q: The following flows through the connective tissue surrounding the blood vessels: O a. Intracellular…
A: Introduction Connective tissue is a group of tissues found throughout the body that help to keep the…
Q: ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAAT…
A: The simplest definition of gene expression is the production of the gene's complementary protein,…
Q: What clinical and laboratory findings would lead to a diagnosis of liver cirrhosis?
A: Acute or chronic liver damage which can be caused by various liver diseases like hepatitis or due to…
Q: The campus of Wilbur Wright College (one of our sister colleges) is listed under the "Tree Campuses…
A: Explanation: The campus of Wilbur Wright College contains a diverse ecosystem. The property is…
Q: Humans are a type of the following: O a. Organ O b. Organelle c. Organism Od. Organ System Oe. None…
A: An organ is a collection of numerous tissue coming together to form a functional unit to perform a…
Which of the following defects in RAS would be tumorigenic? multiple answers
A. |
Deletion of |
|
B. |
Inactivation of Guanine Exchange Factor (GEF) |
|
C. |
Mutation at amino acid 61 that prevents hydrolysis of bound GTP |
|
D. |
Inactivation of GTPase Protein (GAPS) |
|
E. |
Mutation that prevents binding of GTP |
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images
- Which of the following consequences of mutations would likely to be associated with an increased cancer risk? (select all that apply)? A. Truncation of the EGF receptor B. Constitutive activation of K-Ras C. Amplification of myc D. Truncation of H-Ras due to a premature stop codon E. Amplification of ErbB2Briefly describe the following properties of the Ras GTPases: a) Size, structure and cellular localization (for structure I want to know if they are lipidated and any other unique features) , b) How are they activated and inactivated (i.e. include the GEFs and GAPs), c). Give an example of downstream effector proteins, d). Are they or could they be involved in human cancer.Tumor cells from a person with leukemia have been analyzed to determine which oncogene is involved in the transformation. After partial sequencing of the gene, the predicted gene product is identified as a tyrosine kinase. Which of the following proteins would most likely be encoded by an oncogene and exhibit tyrosine kinase activity? A. Nuclear transcriptional activator B. Epidermal growth factor C. Membrane-associated G protein D. Platelet-derived growth factor E. Growth factor receptor
- We have studied Ras signal transduction pathway. In an experiment, two different mutations were produced using different chemicals. The proteins with mutation are listed below. State what will be the effect of each mutation and explain whether it will result in cell proliferation or not. GEF protein GTPaseAberrant signaling through the Ras-BRaf-MAPK signal transduction pathway drives many cancers. This makes the pathway an attractive drug target, and many small molecules have been developed that target either Ras, BRaf or MAPK. In malignant melanoma, one mutation in particular, where valine 600 of Braf is mutated to a glutamic acid (V600E), is found in the majority of cases. This mutation makes BRaf activation independent of upstream Ras activity. Would a small molecule that targets Ras be effective in a melanoma case driven by Braf V600E? Explain your answer.Describe the common signal transduction event that is perturbed by cancer-promoting mutations in the genes encoding RAS and NF-1. Why are mutations in RAS more commonly found in cancers than mutations in NF-1?
- Which of the following mutations would produce a form of the Ras protein that would be more difficult to inactivate than normal Ras? Briefly explain your reasoning.(i) A mutation that allows Ras to cleave (hydrolyze) GTP more rapidly than usual(ii) A mutation that causes Ras to bind Ras-GAP more tightly than usual(iii) A mutation that causes Ras to cleave (hydrolyze) GTP more slowly than usual5) Briefly explain why the formation of a tumour can pose a risk to a person's homeostasis. 6) The functioning of the "Ras/MAPK" signal transduction pathway is absolutely essential in order for cells to grow, divide, and migrate. One important protein that is part of this pathway is BRAF. This protein is a kind of enzyme called a "kinase" – an enzyme that transfers a phosphate group onto another protein. In some melanomas, a mutated form of BRAF called BRAF Val600AGlu drives the progression of the cancer. The drug "vemurafenib" slows the progression of the cancer by slowing the production of the mutant BRAF protein. (National Cancer Institute. 2019. Types of Cancer Treatment. Retrieved from: https://www.cancer.gov/about-cancer/treatment/types/ Is this an example of a traditional cancer therapy or a targeted therapy? Briefly explain your reasoning in the space provided, using information provided in the text to support your answer. Type of therapy (traditional or targeted)?: Brief…Which of the following are characteristics of “small” monomeric Ras GTPases? A. Membrane bound B. Act as molecular switches between GTP & GDP C. They interact with receptors directly to regulate upstream events D. They are activated upon GTP binding E. None of the above
- 6) The functioning of the "Ras/MAPK" signal transduction pathway is absolutely essential in order for cells to grow, divide, and migrate. One important protein that is part of this pathway is BRAF. This protein is a kind of enzyme called a "kinase" – an enzyme that transfers a phosphate group onto another protein. - In some melanomas, a mutated form of BRAF called BRAF Val600AGlu drives the progression of the cancer. The drug “vemurafenib" slows the progression of the cancer by slowing the production of the mutant BRAF protein. (National Cancer Institute. 2019. Types of Cancer Treatment. Retrieved from: https://www.cancer.gov/about-cancer/treatment/types/ Is this an example of a traditional cancer therapy or a targeted therapy? Briefly explain your reasoning in the space provided, using information provided in the text to support your answer. Type of therapy (traditional or targeted)?: Brief explanation: 19I just read an abstract of the paper “Disulfide bond-disrupting agents activate the tumor necrosis family-related apoptosis-inducing ligand/death receptor 5 pathway” and noted that “DDAs and TRAIL synergize to kill cancer cells and are cytotoxic to HER2+ cancer cells with acquired resistance to the EGFR/HER2 tyrosine kinase inhibitor Lapatinib.” For the last sentence, I am not sure the meaning of the “acquired resistance to the EGFR/HER2 tyrosine kinase inhibitor Lapatinib”. Is the “acquired resistance ... to inhibitor” a good thing or bad thing, as far as the synergize effect of DDAs and TRAIL”? Hope that expert can help.Which of the following statements are correct about cytoplasmic signaling in cancer cells? Multiple answers. A. Only minor modifications of cell control machinery are required for normal cells to become highly proliferating cancer cells B. Immediate early genes are induced in the presence of protein synthesis inhibitors C. Many immediate -early genes are oncogenes D. Delayed early genes are highly expressed in the presence of protein synthesis inhibitors E. Delayed early genes are highly expressed in normal cells in the absence of growth factors