Q: Explains in a paragraph of 700 words the evolution of the beluga in Canada, until now its…
A: The Hudson Bay, the St. Lawrence Estuary, and Canada's Northern area are home to the beluga, also…
Q: A cell in G1 of interphase has 8 chromosomes. How many chromosomes, and how many DNA molecules will…
A: A cell's growth and division are accompanied by a sequence of processes known as a cell cycle. A…
Q: 20. With respect to the Laws of Thermodynamics, what is the most important of the following roles of…
A: The process of photosynthesis takes place when the sunlight strikes the leaves and excites…
Q: Questions 1. Who are the characters in this real-life scenario? What medical situation does each of…
A: We all know that our all physiological information are stored in our genetic material,DNA.But if…
Q: What is the most common portal of entry? Question 12 options: a) food & water b) mucous…
A: E. Respiratory aerosols
Q: Name at least two diseases that have been eradicated due to immunization.
A: Certain diseases can be fatal and highly severe. Since of how quickly they spread, it is important…
Q: What makes up composition of the body
A: The human body is a complex organism composed of various systems and structures that work together…
Q: which products of the light independent reactions are used by the light dependent reactions
A: Photosynthesis is the basis of the food chain in terrestrial and aquatic ecosystems; it supports the…
Q: A snapdragon plant with violet flowers was crossed with another such plant with white flowers. The…
A: INCOMPLETE DOMINANCE It is a gene interaction in which both alleles of a gene at a locus are…
Q: Joe went to the emergency room, where he complained of severe pains in the lower right quadrant of…
A: Imaging techniques play a crucial role in the diagnostic process for many medical conditions. These…
Q: Evaluate the suitability of DNA and RNA as genetic material and justify the suitability of the one…
A: The evaluation of suitability of DNA and RNA as genetic material can be established on the…
Q: Part III-PGD? Suzanne and David decided to have children. They wanted to ensure that their children…
A: NOTE: according to the answering guidelines, I am going to answer only first question. Please post…
Q: The function of DNA ligase is to: a. Catalyze formation of phosphodiester bonds between adjacent…
A: DNA ligase plays a crucial role in the synthesis, repair, and replication of DNA molecules. It is an…
Q: Mutations: The codon GGA encodes the amino acid glycine. Identify the type of mutation for each of…
A: Central dogma is a very basic procedure of producing proteins.In this process mRNA plays a vert…
Q: PROTEIN VOCABULARY TERMS LIST Use the terms below to fill in the blanks. Amino Acid Carboxyl Group…
A: Proteins are usually called as building block of the life. Many proteins play important roles in…
Q: Write the 3 short term effects and 3 long term effects in given classification of substance
A: Drugs are the substances which have physical or physiological effects on the body.Drugs are used to…
Q: The main tools the U.S. government provides that can help plan a healthy diet are __________. DRIs,…
A: A healthy diet includes a variety of nutrient-dense foods from all food groups, including fruits,…
Q: 3. Why is rubisco considered to be the most important enzyme on earth? What does it do?
A: Introduction:- Ribulose-1,5-bisphosphate carboxylase/oxygenase, commonly known as rubisco is an…
Q: Fossils found in strata reveal that - Select one: O a. older strata carry fossils that differ…
A: As the question has more than one questions so here we have answered only the first question.…
Q: Suppose that goats have one gene that codes for color, where A is brown and a is white. The goats…
A: The alleles that an individual carries are inherited from each parent. The dominant…
Q: 1. Discuss the excretion and retention of proteins by the glomerulus.
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Considering its metabolic properties, what advantage might the phototroph in the “Chlorochromatium…
A: Introduction: A phototrophic consortium known as Chlorochromatium aggregatum may be the highest…
Q: 3. What is the critical role of oxygen in cellular respiration, that without it, aerobic respiration…
A: Cellular respiration: A sequence of chemical processes known as cellular respiration convert glucose…
Q: Part II-A New Dilemma Suzanne and David decided that Suzanne would take the diagnostic test. In…
A: Both decided for Suzanne to undergo the diagnostic procedure. Suzanne and David are now faced with a…
Q: 9. For organism Z, 2n = 36. What is the diploid chromosome number (2n) and DNA content (C) of…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Does the atmospheric CO2 level stay the same throughout the year or does it change throughout the…
A: Atmospheric CO2 level majorly depends on the photosynthesis process of plants.
Q: Problem #4 In cattle, coat color is controlled by two codominant alleles. One allele produces a red…
A: Example 1 shows the dihybrid cross where two characters are involved. Homozygous condition is always…
Q: Lipids most abundant form are Triglycerides building blocks are 1 If a triglyceride only contains…
A: Introduction:- Lipids and Proteins are categorised under bio-macromolecules. Proteins are higher…
Q: 14. What is required to convert Ribulose bisphosphate to 3-phosphoglycerate (PGA)? a. b. the…
A: The answer is--- d. The addition of CO2 and water is required to convert ribulose bisphosphate to…
Q: Describe the interactions of Agrobacterium tumefaciens with its host plant. Why is this plant…
A: Introduction: The bacterial pathogen Agrobacterium tumefaciens is a vital component in plant genetic…
Q: during the absolute refractory period k+ channels are open while na+ channels are 1. activated…
A: The phrase "refractory phase" refers to the period of time when a specific cell or organ is unable…
Q: 2. Consider the energy systems an 800m track athlete would use during a race. In a scenario where…
A: a) During the first 400m of the race they feel strong and quick because the warm up helps them to…
Q: Directions: Use the Punnett Squares from the previous problems to answer these follow up questions.…
A: Note: “Since you have asked multiple questions, we will solve the first question for you. If you…
Q: 2. Which of the following is NOT part of a nucleotide? O Phosphate O Sugar O Glycerol Nitrogenous…
A: As the question contains more than one questions, here we have answered the second question.…
Q: 2. In Glycolysis, glucose is broken down into 2 pyruvate molecules, how many ATP are needed to…
A: Glycolysis is the process that helps to produce pyruvate from glucose. This process is much needed…
Q: in the absence of natural disturbance(or human intervention) some habitat types in a protected area…
A: Habitat is a place where the organism gets everything needed to live a life and to reproduce.…
Q: NH₂ 1 N= CH: A B C C-N 3-4 HC HICI I OH B HICIO с OH E HICIH -21 High-energy bonds 044 P-O G O-P-O-…
A: ATP stands for Adenosine triphosphate.It is the energy currency of the cell.It is considered as…
Q: 1.2 Answer these "a, b, c" questions, well detailed with a lot of information filled in. It is…
A: Marine creatures such as beluga whales are critical to the health and balance of marine ecosystems,…
Q: What is a technique often used to study the three-dimensional structure of proteins? A.X-ray…
A: Proteins are made up of amino acids, which is the primary structure of proteins, the secondary…
Q: During the action potential waveform, the voltage returns to the resting membrane potential at -70mV…
A: An action potential is a rapid change in the electrical potential of a cell membrane, caused by the…
Q: presented in this MMWR article, explain the trends that were seen with giardia infection across the…
A: The trends seen with Giardia infection across the nation from 2011-2012 showed an overall decrease.…
Q: 11. What is the result of light energy absorbed by photosystem I? a. b. C. d. It energizes an…
A: In a non-cyclic photophosphorylation Photosystem I (PS700) absorbs light energy. It results in the…
Q: How can public health infrastructure components be managed and enhanced to improve the performance…
A: Good health allows individuals to maintain the strength and energy needed to participate in…
Q: Explain how the temperature of the human body is regulated
A: Maintaining constant bodily conditions is part of homeostasis. The stability of the environment is…
Q: Discuss the importance of data when observing something like the outbreak of cholera or even the…
A: The scientific method is a process used in science and research to educate ourselves and find…
Q: Construct a table similar to that in Figure 2.12 for the different stages of meiosis, giving the…
A: Introduction In sexually reproducing organisms, a kind of cell division known as meiosis results in…
Q: In a clinical trial it might seem unethical to compare a drug candidate versus a placebo rather than…
A: The term “Placebo” refers to a substance that is manufactured to have no therapeutic value. For…
Q: Filarid (microfilaria) parastites in lymphatics would most often cause which of the following…
A: A parasitic condition known as filariasis is brought on by an infection with roundworms of the…
Q: ompares the processes of diffusion, facilitated transport, osmosis, and active transport.
A: Diffusion, facilitated transport, osmosis, and active transport are the ways by which a cell takes…
Q: Please discuss various methods of gene regulation in prokaryotic cells including the lac operon, the…
A: Prokaryotic cells, such as bacteria, have evolved a variety of mechanisms to regulate gene…
Step by step
Solved in 2 steps
- 5b. When you mutagenize a diploid organism, chances are astronomically high that you will be creating a heterozygote on the spot. Why would your mutation be heterozygous and not homozygous?2. Discuss the use of transposons as mutagens in bacteria.13. In your own words, identify one of the reasons why it is difficult to assemble a genome and explain why .
- 1. Determine the approximate number of amino acids that would be missing in the telomerase protein of a person who has the autosomal form of dyskeratosis congenita in which a segment of the normal gene has been deleted. b. In some patients with autosomal dyskerptosis congenita , the disorder is caused by one or two nitrogen base substitutions that change the sequence of the DNA the telomerase gene. Describe what would happen to the etlomerase protein if a triplet of the telomerase gene that was normally ACC mutated to become ACT Explain your answer. c. i Identify a field of research, other than days keratosis congenita , that could use knowledge gained about telomerase and telomeres . Explain how this information might be used. c. ii Evaluate how this research could affect either an individual or society. Include one potential advantage and one potential disadvantage in your evaluation.6a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of mutation occurred: AAGCTTAC1. How would you determine experimentally mutagenesis caused by stress? 2. What are the evolutionary advantages associated with stress-induced mutagenesis? 3. How do bacteria cope with mutagenesis? List and explain at least three way
- 6. The starting sequence of a gene changed from AUGTTCGACGTG, to AUGTTTTCGACGTG What type of mutation is this? To answer the question, please explain: I) what the mutation is? 2) what types of mutation do you know? 3) what are the possible outcomes of mutations? 146. Why do you think the Ames test is preferable to the use of animal models to screen chemical compounds for mutagenicity?Briefly discuss the process of gene therapy, including some of its technical challenges.
- 1. Methods of gene therapy 2. Explain Small RNAs and long non coding RNA. 3.what is name of the technique that would help a person who inherited LFS to have a child without the defective allele? 4 .Describe the main technique for amplifying a segment of DNA (like the one you suspect is involved in Lee’s cancer) from a complex mixture of genomic DNA. Remember that the entire human genome sequence is known. (Hint: This is a technique that is commonly used by laboratories that do genetic testing and various other applications of molecular biology.) 5. If Dr. Aikenhed wanted to see if there was mutation within the protein-coding sequence of the gene implicated in this disorder (as opposed to mutations afecting regulatory elements), what technique involving dideoxynucleotides could be used? Briefy describe this technique.3. Explain in your own words the methods used to collect your cheek cells and to extract the DNA. Be sure to clearly explain the significance of using InstaGene solution and water baths1. List the complementary non-coding DNA sequence. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .