32. Would you expect to find hydrophobic amino acids on the external surface or internally in proteins? Why? 33. What is required for molecular surfaces/interfaces to interact with one another for a sufficient amount of time (such as an antibody/antigen)? many intermearat only partially replicated. Thus, Meselson and Stahl's experiments showed that DNA replication IS a semiconservative process in which the single strands of the double helix remain intact (are conserved) during a replication process that distributes one parental strand into each of the two daughter molecules (thus the te uonry NOTES

32. Would you expect to find hydrophobic amino acids on the external surface or internally in proteins? Why? 33. What is required for molecular surfaces/interfaces to interact with one another for a sufficient amount of time (such as an antibody/antigen)? many intermearat only partially replicated. Thus, Meselson and Stahl's experiments showed that DNA replication IS a semiconservative process in which the single strands of the double helix remain intact (are conserved) during a replication process that distributes one parental strand into each of the two daughter molecules (thus the te uonry NOTES

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

3. A long DNA will be divided into small fragments, and one of them will be attached to the bead and amplified in Ion Torrent sequencing. The beads with different kinds of fragments will be loaded into different wells. The following graphs show the first forty (40) signals from two different wells. The value of one (1) in the y-axis of the graph corresponds to incorporation of one (1) nucleotide to every DNA strand on a bead. (a) You can observe that in every single step the signals are not the multiples of an integer. Explain why such signals are produced and how we can interpret the signals. (b) Using the first forty (40) signals shown below, please figure out the DNA sequence of the fragment attached to the bead in each well. (c) Based on the sequences of the fragments, can we guess the partial sequence of the original DNA sequence (before fragmentation)? If so, what could it be? (d) In the well #1, when the non-zero signals will show up after the 40 steps? Answer this by the step…
Briefly explain (1) the structure characteristics of DNA, (2) why different DNA molecules (i.e., with different sequences) could adopt the same B-form double helical structure, and (3) how certain proteins could recognize the specific sequences with the common B-form DNA.
1. A DNA fragment was sequenced; however, the scatter-brained professor lost track of the direction of the sequence. The resulting sequence is given, but without the 3' or 5' ends identified. NOTE the sequence listed is double stranded. (a) Find all START codons (in both directions and for both strands) and report the sequence of the two start codon(s) plus the next 3 bases downstream (i.e. 5' to 3' direction) (b) One of the start codons has a STOP codon 5 codons downstream, list the 18 bases that contain the target sequence and the 6 amino acids that this (very short) open reading frame would translate to (c) BONUS: Identify the 3' or 5' ends for lables1- 4 (1) ATATTAAAAAAGGTTTAGGTACGGAACGTCGAAGAGAACTAAACACAAATTAAGTGACAGACAGTTGTC (2) (3) TATAATTTTTTCCAAATCCATGCCTTGCAGCTTCTCTTGATTTGTGTTTAATTCACTGTCTGTCTACAG(4)
Please fill all
DNA Replication: 1. Write in the new (complimentary) strands for each of the two halves of the DNA molecule below to show what the two semi-conserved strands would look like. A G T A C C G G G C A A A C T G C A T T G T G I I I I I I I I I I I I I I I I I I I I I I I I I I T C A T G G C C C G T T T G A C G T A A C A C old strand A G T A C C G G G C A A A C T G C A T T G T G new strand: new strand: old strand T C A T G G C C C G T T T G A C G T A A C A C Gene Expression: 2. Use your DNA strand to construct a part of a messenger RNA molecule. DNA A G T A C C G G G C A A A C T G C A T T G T G mRNA:
When DNA is heated sufficiently, the strands separate. The energy that it takes to separate the DNA is related to the amount of guanine and cytosine bases. Why is this so? (A) Adenine and thymine make 3 hydrogen bonds between each other, and guanine and cytosine don't make any hydrogen bonds. (B) Guanine and cytosine make 3 hydrogen bonds between each other, and adenine and thymine don't make any hydrogen bonds. (C) It takes more energy to break an A-T bond than it does a G-C bond. (D) It takes more energy to break a G-C bond than it does an A-T bond.
3,Compare the free energy, ∆G, of A-T binding and A-C binding, which one is more negative? Does this makes sense in terms of the structure of DNA? Group of answer choices A, ∆G of the A-T binding is more negative than that of the A-C binding, which is consistent with the fact that A-C binding is not favored in DNA helix. B, ∆G of the A-T binding is more negative than that of the A-C binding, which is consistent with the fact that A-C binding is favored in DNA helix. C, ∆G of the A-C binding is more negative than that of the A-T binding, which is consistent with the fact that A-C binding is not favored in DNA helix. D, ∆G of the A-C binding is more negative than that of the A-T binding, which is consistent with the fact that A-C binding is favored over A-T binding in DNA helix.
Based on one strand of a certain segment of DNA with the sequence below, answer the following question: 3’-ATGGATCCCATC-5’ What must the sequence in the other strand be (label the ends)?
a. Do any strands of nucleic acid exist in nature inwhich part of the strand is DNA and part is RNA?If so, describe when such strands of nucleic acidare synthesized. Is the RNA component at the 5′end or at the 3′ end?b. RNA primers in Okazaki fragments are usually veryshort, less than 10 nucleotides and sometimes asshort at 2 nucleotides in length. What does this facttell you about the processivity of the primaseenzyme—that is, the relative ability of the enzymeto continue polymerization as opposed to dissociatingfrom the template and from the molecule beingsynthesized? Which enzyme is likely to have a greaterprocessivity, primase or DNA polymerase III?
1. You are working in a bioengineering lab, and you are asked to create a peptide with a helix with length of 3 nm, a beta strand with length of 35 Å, and a linker containing 25 amino acid residues. a. How many amino acid residues are in this peptide? b. What is the mass of the peptide? 2. Why is quinary structure necessary for a full understanding of how drugs work in cells?
34. Answer and explain
DNA Replication occurs on both prokaryotes and eukaryotes. Although they have a similar genetic flow, there are small differences in between. What are the differences of DNA replication in prokaryotes and eukaryotes? What is/are the major difference/s?