3) The sex of some reptiles, including the American alligator, is determined by the temperature at which the eggs are incubated. For example, incubating them at 33°C produces mostly males, while incubation at 30°C produces mostly females.Scientists recently discovered a thermosensor protein, TRPV4, that is associated with this process in American alligators. TRPV4 is activated by temperatures near the mid-30s, and increases the movement of calcium ions into certain cells involved with sex determination. The results of this scientific investigation will most likely lead other scientists to hypothesize that * human sex cells also contain the TRPV4 protein 0) the TRPV4 protein affects the growth of plants other reptiles may have the TRPV4 protein in their eggs the TRPV4 protein is present in all of the foods eaten by alligators

APC is a tumor suppressor and acts in the Wnt signaling pathway to prevent the TCF complex from turning on Wnt-responsive genes. Mice that lack the gene encoding TCF4 do not have the ability to maintain the pool of proliferating gut stem cells needed to renew the gut lining. What do you predict will happen in mice that lack the APC gene?

Choose only one option:

In the early Drosophila embryo, there seems to be no requirement for the usual forms of cell–cell signaling; instead, transcriptional regulators and mRNA molecules move freely between nuclei. How can that be?

The G-protein Ras is involved in proliferative signaling, and is mutated is a large fraction of human cancers. Almost all mutations in Ras mutate the glycine at codon 12. These mutations lock Ras in an active conformation. How will the GTPase activity of a Ras protein with a G12 mutation compare to a normal Ras protein without the mutation? (10 words maximum)

Match the model organism with the generation time 3 day generation time at room temperature v Choose... Mus musculus 8 week generation time Caenorhabditis elegans 10 day generation time at room temperature Escherichia coli Drosophila melanogaster Arabidopsis thaliana Saccharomyces cerivisiae divides in 90 minutes under optimal conditions divides in 20 minutes under optimal conditions Choose... 6 week generation time Choose...

You have developed an activator of a non-receptor tyrosine kinase. In three different cell types that all contain this receptor your drug has different effects. In cell type A you see activation of gene X and gene Y; in cell type B you note activation of Gene X, but no change in the mRNA levels for Gene Y. In cell type C your drug has no effect on either Gene X or Y. Describe how could each choice (A-D) be a possibility to suit the scenario? a. Genes X & Y are controlled by two separate STATs (STAT X & STAT Y). Cell type A contains both STATs; cell type B contains STAT X only; cell type C has neither STAT. b. Genes X & Y are controlled by two separate STATs (STAT X & STAT Y) and two separate JAKs (JAK X & JAK Y). Cell type A contains both STATs and JAKs; cell type B contains both STATs but JAK X only; cell type C has both STATs but neither JAK. c. Genes X & Y are controlled by two separate STATs (STAT X & STAT Y), two separate JAKs (JAK X & JAK Y) and…

Mutation in the fibroblast growth factor receptor (FGFR) gene results in achondroplasia (dwarfism), which is a dominant condition caused by a single base substitution (GGG>AGG) that changes the amino acid glycine at position 480 to arginine (G480R) in the FGFR protein. FGFR is normally active when FGF binds to it, but the mutant FGFR is always on to stimulate signaling that inhibits excessive bone growth. How can gene therapy be used to treat achondroplasia? Select all that apply. RNAi that knocks down the mutant FGFR expression Adeno-associated viral (AAV) vector that carries the wild-type FGFR Retroviral vector that carries the wild-type FGFR CRISPR with the wild-type FGFR donor DNA

Which of the following statements is FALSE? The Delta protein itself is a transcription regulator; it controls the development of neural cells in Drosophila. Not all receptors trigger complex signaling cascades that use multiple components to carry a message to the nucleus; some take a more direct route to control gene expression. Some receptors activate a fast track to the nucleus; one such receptor is the protein Notch, which is activated by the binding of the transmembrane signal protein Delta. In plants, the ethylene signaling pathway turns on genes by relieving inhibition.

What is the abbreviated name of the human gene that contains the following sequence CAGATTGTGAAGAGGTCTCTTGA? ATR HBB XPA FGFR3 IDS XRCC1 p53 F8 APC ERCC3