26. DNA from a bacterial strain that is his* leu* lac* is used to transform a strain that is his leu lac". The following percentages of cells are transformed: Donor Recipient strain strain Genotype of Percentage transformed cells of all cells his* his leu his* leu* leu* lact 0.02 lac lac* his* leu* lac 0.00 hist leu lac* 2.00 his* leu lac 4.00 his leu* lac* 0.10 his leu 3.00 lac* his leu* lac 1.50

26. DNA from a bacterial strain that is his* leu* lac* is used to transform a strain that is his leu lac". The following percentages of cells are transformed: Donor Recipient strain strain Genotype of Percentage transformed cells of all cells his* his leu his* leu* leu* lact 0.02 lac lac* his* leu* lac 0.00 hist leu lac* 2.00 his* leu lac 4.00 his leu* lac* 0.10 his leu 3.00 lac* his leu* lac 1.50

Name: Which two genes are closest? 26. DNA from a bacterial strain that is h
Uploaded: 2024-03-20T06:43:04.000Z
Channel: Bartleby
Description: Which two genes are closest? 26. DNA from a bacterial strain that is his* leu* lac* is used totransform a strain that is his leu lac". The following percentagesof cells are transformed:Donor Recipientstrain strainGenotype of Percentagetransformedcell

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter17: Bacterial And Viral Genetics

Section: Chapter Questions

Problem 1ITD

See similar textbooks

Similar questions

#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
#3 HaelII --- 5’ CC ↓ GG 3’ 5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’ TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Eight mutant bacteriophage strains cannot lyse a certain type of bacteria that can be lysed by wild-type bacteriaphages. The mutant strains were allawed to infect the bacteria in a complementation test. A "+ indicates that lysis occurred with coinfection.Aindicates that lysis did not occur. GKWTMAQC G -++|+ ++l+ - K. - + - ++ +| + -+| - |-++ + + + M - + + + A cistron is defined by no complementation in the Ciş : configuration. Haw many genes are controlling lysis in this bacteriophage? (Use a number not a word in the space) 3 Which of the following strains below are defective in the same gene as strain Q? Answer yes if the strain is defective or no if it is not. Strain Defective A N/A
Eight mutant bacteriophage strains cannot lyse a certain type of bacteria that can be lysed by wild-type bacteriophages. The mutant strains were allowed to infect the bacteria in a complementation test. A "+" indicates that lysis occurred with coinfection. A "-" indicates that lysis did not occur. GKWTMAQC G- ++++- K W T M A Q C - + +++ - ++++ - + + - + - + - - + + + A cistron is defined by no complementation in the How many genes are controlling lysis in this bacteriophage? (Use a number not a word in the space) configuration.
All are true for DNA polymerase EXCEPT: / Almal geld vir DNA-polimerase, BEHALWE: A. generates dsDNA from SSDNA / genereer dsDNA vanaf SSDNA B. requires a primer with a free 5'- OH end, but the 3'-end may be phosphorylated / benodig 'n voorvoerder met 'n vrye 5'-OH-groep, maar die 3'-einde kan gefosforileer word. C. copies the sequence of nucleotides of one strand in a complementary fashion. / kopieer die volgorde van nukleotiede van een streng komplementêr. D. synthesizes new strands by adding successive nucleotides in the 5'→3' direction. / sintetiseer nuwe stringe deur opeenvolgende nukleotiede in die 5 '→ 3' rigting toe te voeg. E. copies the sequence of nucleotides of one strand to form a new second strand. / kopieer die volgorde van nukleotiede van een
An ade+ arg+ cys+ his+ leu+ pro+ bacterial strain is knownto be lysogenic for a newly discovered phage, but the siteof the prophage is not known. The bacterial map isleucysarghisadeproThe lysogenic strain is used as a source of the phage, andthe phages are added to a bacterial strain of genotypeade- arg- cys- his- leu- pro-. After a short incubation,samples of these bacteria are plated on six differentmedia, with the supplementations indicated in thefollowing table. The table also shows whether colonieswere observed on the various media.PresenceMedium Ade Arg Cys His Leu Pro of colonies1 - + + + + + N2 + - + + + + N3 + + - + + + C4 + + + - + + N5 + + + + - + C6 + + + + + - NNutrient supplementation in medium(In this table, a plus sign indicates the presence of anutrient supplement, a minus sign indicates that asupplement is not present, N indicates no colonies, and Cindicates colonies present.)a. What genetic process is at work here?b. What is the approximate locus of the prophage?
Second letter A G UCU UCC UAU. Tyr UAC. UUU1 Phe UUC. UUA UUG. UGC Ser }Leu UAA Stop UGA Stop UAG Stop |UGG Trp UCA UCG CAU His CUU CỤC CCU ССС ССА CGU CGC Arg Leu CÁCS Pro CỦA CUG CGA CAAGIN CGG, Gln CAG, CCG J AAU Asn ACU АСC АСА AUU AGU Ser AUC }le A AUA AAC. Thr А AGC AGA AUG Met | ACG ] AAG Lys AG. GUU GUC GCU GAU1 AAsp GACS Ala GAA GGU GGC GCC Val Gly GGA G GUA GCA GUG GCGJ GAG Glu GGG Which peptide is the least likely to be made on the ribosome and why? а. Third letter DUAG 5UAG DUAG DUAG First letter
U UUU UAU 11yr Phe UUC UUA Leu UUG Jle UCU UCC UCA UCG UGU UGC Cys UGA Stop UAG Skop UGG Trp UAC Ser UAA Stop CUU CUC CỦA CUG CAU JHis CAC CGU CGC CGA CGG CCC Leu Pro Arg ССА Delete CCA CG CAA CAG JGIN Gln AUU AUC le AUA AUG Met AGU 1 Ser AGC AGA AGGJArg 1. ACU ACC The ACA ACG AAU M AAC AAA AAG Jlys JAun ATG AAC TAC CTA GGG ACA GAU JAsp GAC GAA GAG JGlu GUU GUC Val G GUA GCU GCC GCA Ala GCG GGU GGC Gly ATG ACC TAG GGA CA GGA GGG GUG G. Compare translation before and after the deletion. What effect might it have on gene function? Asp Daspartic acid lleI isolcucine Thr T threonine Leu L leucine Ser S serine Туr Y tyrosine Glu E glutamic acid Phe F phenylalanine Pro P proline His H histidine Lys K Arg R Gly G glycine lysine Ala A alanine arginine Cys C cysteine Trp W tryptophan Val V valine Gln Q glutamine Met M methionine Asn N asparagine Second Position UGU 1Cy UCU UCC Ser UCA UG UUU Phe UAU UAC Ty UAA Slop UGA Stop UAG Slop UGG Trp UGC UUC U UUA Leu ] low UUG CUU CÚC A Leu CCU CCC Pro…
Find the complement DNA sequences to the following DNA sequences:Sequence # 1: GATATAGTSequence # 2: GAGGTTCSequence # 3: AACTAGATSequence # 4: CCTATAAGSequence # 5: AACGTGAT
Strain W Strain X Strain Y Strain V Strain Z Under these conditions, rank the bacterial strains from most (1) to least (5) competitively dominant. Strain V [ Choose ] Strain W [ Choose ] Strain X [ Choose ] Strain Y [ Choose ] Strain Z [ Choose ] > > >
EboV Strain 1 EboV Strain 1 (Circle the mutated bases) CCA TGT AAG TGG TTA mRNA Protein