21. Single nucleotide polymorphisms (SNPS) mutations are rarely fatal. Which of the following is not an explanation of this fact? a. only about 2 % of the human genome codes for proteins b. many genes are not expressed in most cells c. there are two copies of a gene present d. most SNPS do not code for an extremely important part of a protein e. all of the preceding are satisfactory explanations as to why SNPS are rarely fatal.

21. Single nucleotide polymorphisms (SNPS) mutations are rarely fatal. Which of the following is not an explanation of this fact? a. only about 2 % of the human genome codes for proteins b. many genes are not expressed in most cells c. there are two copies of a gene present d. most SNPS do not code for an extremely important part of a protein e. all of the preceding are satisfactory explanations as to why SNPS are rarely fatal.

Name: 21. Single nucleotide polymorphisms (SNPS) mutations are rarely fatal
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 21. Single nucleotide polymorphisms (SNPS) mutations are rarely fatal. Which of the following is not anexplanation of this fact? a. only about 2 % of the human genome codes for proteins b. many genes arenot expressed in most cells c. there are two c

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 10QP: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense...

See similar textbooks

Similar questions

1. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 3’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 5’ a. What is the amino acid sequence based on this mRNA? b. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?
1. If a mutation occurs in a coding region a. it will cause a change or changes in the normal (wild type) amino acid sequence. b. the protein may not form correctly and as a result does not perform the intended function. c. the type of mutation can be a missense mutation if there is some or limited protein function. d. the type of mutation can be a nonsense mutation if there is no protein function. e. all of the above 2. If a mutation occurs in a non-coding region: a. it will cause no change in the normal (wild type) amino acid sequence. b. the protein is unaffected and still functions correctly. c. the type of mutation is called a silent mutation. d. the protein may not form correctly and as a result does not perform the intended function. e. all of the above
8. Which of the following gene mutations is most likely to affect correct protein production? The boxes are the exons and the lines are the introns in the gene a. b. C. d. Site 1 Site 2 Explain WHY. 1+ Site 3 Site 4 a two base-pair deletion at Site 1 that removes two "G-C" nucleotide pairs from the gene sequence a single base-pair substitution at Site 2 that changes a tyrosine-encoding amino acid (TAC) to a stop codon (TAA) a single base-pair substitution at Site 3 that changes one alanine-encoding codon (GCC) to another (GCA) a single base-pair insertion at Site 4 that shifts the reading frame for subsequent codons
1. A monogenic disease is a disease caused by a mutation in a single gene. For instance, sickle-cell anemia is caused by a mutation in the HBB gene, which codes for the B- globin chain of hemoglobin. The beginning of HBB is shown here: 5'-ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACT...-3' A. Translate this HBB sequence into an amino acid sequence. B. In terms of amino acids, what is the result of the sickle cell mutation, wherein the bolded red A is changed to a T? This single mutation causes hemoglobin to aggregate, causing red blood cells to deform into a sickle-like shape rather than the normal “biconcave disk" shape. C. What would happen if the bolded blue A were mutated to at T? (This is hypothetical; it's not a mutation found in sickle-cell disease.)
1. How would the following affect BOTH transcription and translation of a particular multi- exon gene in a eukaryotic cell (for each address both transcription and translation of a particular multi-exan gene; also treat each independently): A mutation abolishing kinase activity in TFIIH a. b. A mutation abolishing mRNA binding in the snRNP U1 С. A mutation in aminoacyl tRNA synthetase for isoleucine such that it can't bind ATP (assume there is an isoleucine in the code)
8. Which of the following amino acids in hemoglobin accepts proton H+ when red blood cells reach tissues? A. Histidine B. Aspartate C. Asparagine D. Glutamine E. Serine 9. Which region (A to D) of the DNA strands shown can serve as the template for transcription of the region of an mRNA that contains the initial codon for translation of a protein with 300 amino acids? B 5' AGATGCCCТАAGGTCATTGTT 3' 3' TCTACGGGATTCCAGTAACAA 5' C A. Α В. В С. С D. D E. None of the above
5. A mutant strain of Salmonella bacteria carries a mutation of the rho protein t hat has full activity at 37°C but is completely inactivated when the mutant strain is grown at 40°C. (Question # 21; Chapter 8-Genetics: An Integrated Approach). Speculate about the kind of differences you would expect to see if you compared a broad spectrum of mRNAs from the mutant strain grown at 37°C and the same spectrum of mRNAs from the strain when grown at 40°C. Are all mRNAs affected by the rho protein mutation in the same way? Why or why not?
If a gene is mutated, then it may consequently affect the expressed in the central dogma which then may lead to alter the production/function of other bio-molecules. Select one: a. lipids b. carbohydrate С. DNA Ca d. protein Do Is w Wha ( Previous page Next page https:// Jump to... What Mar 13. These m https://bic 2.2A: V MacBook Pro esc n m-wanry ur @ # $ % & 1 2 3 4 6 Q W E Y tab А S D F G caps lock
23. All of the following are beneficial effects of mutation, EXCEPT: * a. basis for skeletal disease therapy b. resistance to some diseases like HIV c. used to help treat or cure diseases like heart-related problems d. weakens the ability of the leukocytes to fight diseases and infection
3. A missense mutation results in the presence of a different amino acid than was encoded by the parental sequence. This type of mutation can have a drastic effect or no effect at all depending on the importance of the amino acid and the type of amino acid that replaces it. Some amino acids are structurally similar and may be able to act as viable substitutes for each other. For example, changing one acidic amino acid to another may not affect the final protein, but changing a polar amino acid to a nonpolar amino acid will likely disrupt the structure. Please explain what mutations occur in HBB gene of abnormal hemoglobin and their effect on the function of the protein.
6. Similar to the class notes (Intro to Genetics), a segment of DNA (shown below) contains a promoter segment (the first 9 base pairs), a ribosome binding segment (the next 6 base pairs), and a segment that codes for protein synthesis which is started by the rest of the base pairs. ACTCCATTGAACCATTTCTATGATCCGCTAACG-... TGAGGTAACTTGGTAAAGATACTAGGCGATTGC-... A. When the DNA is induced to be copied to mRNA, the top strand is coding, meaning that the mRNA makes an identical copy of the lower strand (replacing T with U) The mRNA copy starts with the ribosome binding sequence. What is the sequence of the mRNA that will go to the ribosomes? B. What are the first 6 amino acids of the protein that are coded for by the mRNA? C. What would the amino acid sequence be if... i. a transition mutation occurred on the final G in the mRNA? ii. all of the G & C bases in the protein synthesis portion had transition mutations? iii. a point deletion mutation occurred in the ATA sequence (in the lower strand…
Table of the Standard Genetic Code Middle base 5'- C_-3' UCU Ser (S) |UAU Tyr (Y) UCC Ser (S) UAC Tyr (Y) UCA Ser (S) UCG Ser (S)UAG Ter CCU Pro (P) CAU His (H) CCC Pro (P) CCA Pro (P) CAA GIn (Q) CCG Pro (P) CAG GIn (Q) 5'- _U -3' 5'-_A_-3' 5'-_G_-3' 5'-U_-3' UUU Phe (F) 5'-U_-3' UUC Phe (F) 5'-U_-3' |UUA Leu (L) 5'-U_-3' UUG Leu (L) 5'-C_-3' |CUU Leu (L) 5'-C_-3' |CUC Leu (L) 5'-C_-3' CUA Leu (L) 5'-C_ -3' CUG Leu (L) UGU Cys (C) 5'-_U-3' 5'-_C-3' 5'-_A-3' UGG Trp (W) 5'-_G-3' 5'- U-3' 5'-C-3' 5'-_A-3" 5'- G-3' 5'- U-3' 5'-_C-3' 5- А-3' 5'-_G-3' GCU Ala (A) GAU Asp (D) GGU Gly (G) 5'-_U-3' 5'-C-3' GGA Gly (G)5'-_A-3' GGG Gly (G) 5'-_G-3' UGC Cys (C) UGA Ter UAA Ter CGU Arg (R) CGC Arg (R) CGA Arg (R) CGG Arg (R) ACU Thr (T)|AAU Asn (N) AGU Ser (S) AAC Asn (N) AGC Ser (S) AGA Arg (R) AGG Arg (R) CAC His (H) 5'-A_-3' |AUU lle (1) 5'-A_-3' AUC Ile (1) 5'-A_-3' |AUA lle (1) 5'-A_-3' |AUG Met (M) ACG Thr (T) AAG Lys (K) 5'-G_-3' GUU Val (V) 5'-G_-3' GUC Val (V) 5'-G_-3' GUA Val (V)…