12. How many chromosomes are in a human body cell? 46 How many homologous pairs? 23 13. What are duplicated chromosomes when connected together called? Sister chromatics 14. What holds chromatids together? Centromere Cell Reproduction 15. What is asexual reproduction? 16. What is asexual reproduction in bacteria called? 17. Do some eukaryotic organisms reproduce asexually? If so, give examples. NS FC SUR fall p n cho e ref re bolles ens allons Mitosis 18. Name two things that happen in prophase. Chromosomes condense, nuclear membrane disolve 19. What are spindle fibers? What cell organelle makes spindle fibers? 20. What happens to the chromosomes during metaphase? 21. What happens to the chromosomes in anaphase? 22. Where are the chromatids in telophase? opposite poles 23. Think about it: How is cytokinesis both the same and different in plant vs. animal cells? 24. Most cells are in interphase. Identify and label as many stages of mitosis in this picture as you can: I Interphase Telophase 25. What type of cell is pictured: Plant or animal? Plant 03 Anophose Prophase 2

7

What is the function of the replication enzymes during S phase of the cell cycle?1. Holding the sister chromatids together until they are separated during mitosis2. Keeping the DNA tightly coiled3.Copying the DNA in the chromosomes4. Pushing the sister chromatids to opposite poles of the cell

1. It is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of DNA as a template, create the complementary strand:GCTCCTTACGGGCCCAATGACCTGAATGTACGAGATCCCATCCTT

Answer Space In the answer space on the right, draw in the chromosomes of cell A. Your drawing should show the usual result of the process of meiosis.

10

10 10 The yellow arrow indicates the structure that O forms the cleavage furrow. O organizes spindle fibers. O connects sister chromatids. O connects homologous chromosomes. eduction (1).ppt e Chapter 11-1 (1) ppt