12. How many chromosomes are in a human body cell? 46 How many homologous pairs? 23 13. What are duplicated chromosomes when connected together called? Sister chromatics 14. What holds chromatids together? Centromere Cell Reproduction 15. What is asexual reproduction? 16. What is asexual reproduction in bacteria called? 17. Do some eukaryotic organisms reproduce asexually? If so, give examples. NS FC SUR fall p n cho e ref re bolles ens allons Mitosis 18. Name two things that happen in prophase. Chromosomes condense, nuclear membrane disolve 19. What are spindle fibers? What cell organelle makes spindle fibers? 20. What happens to the chromosomes during metaphase? 21. What happens to the chromosomes in anaphase? 22. Where are the chromatids in telophase? opposite poles 23. Think about it: How is cytokinesis both the same and different in plant vs. animal cells? 24. Most cells are in interphase. Identify and label as many stages of mitosis in this picture as you can: I Interphase Telophase 25. What type of cell is pictured: Plant or animal? Plant 03 Anophose Prophase 2

12. How many chromosomes are in a human body cell? 46 How many homologous pairs? 23 13. What are duplicated chromosomes when connected together called? Sister chromatics 14. What holds chromatids together? Centromere Cell Reproduction 15. What is asexual reproduction? 16. What is asexual reproduction in bacteria called? 17. Do some eukaryotic organisms reproduce asexually? If so, give examples. NS FC SUR fall p n cho e ref re bolles ens allons Mitosis 18. Name two things that happen in prophase. Chromosomes condense, nuclear membrane disolve 19. What are spindle fibers? What cell organelle makes spindle fibers? 20. What happens to the chromosomes during metaphase? 21. What happens to the chromosomes in anaphase? 22. Where are the chromatids in telophase? opposite poles 23. Think about it: How is cytokinesis both the same and different in plant vs. animal cells? 24. Most cells are in interphase. Identify and label as many stages of mitosis in this picture as you can: I Interphase Telophase 25. What type of cell is pictured: Plant or animal? Plant 03 Anophose Prophase 2

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

5. Draw metaphase I of a cell where 2N = 6. Label a sister chromatid, non-sister chromatid, chromosome, tetrad, centromere and a gene locus for eye colour located on the shortest chromosome.
Part 1 This diploid cell undergoes meiosis (chromosomes replicate prior to meiosis). Which of the cells below represent(s) a possible way that the replicated chromosomes could line up in metaphase I of meiosis? Assume that no crossing-over occurs. O Bb Bib MP bb BB AF Bb Bb bB bib BB X
2. If you were observing the chromosomes during metaphase I of meiosis, you would see that the chromosomes are arranged as Dunwound thin strands of chromatin O homologous pairs of chromosomes O single chromosomes O unpaired duplicated chromosomes
6. Please answer
38
7
What is the function of the replication enzymes during S phase of the cell cycle?1. Holding the sister chromatids together until they are separated during mitosis2. Keeping the DNA tightly coiled3.Copying the DNA in the chromosomes4. Pushing the sister chromatids to opposite poles of the cell
1. It is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of DNA as a template, create the complementary strand:GCTCCTTACGGGCCCAATGACCTGAATGTACGAGATCCCATCCTT
B4.28m ext/map/index.html?_con=con&external_browser=0&launchUrl=https%253A%252F%252Fnewconnectmheducation.com6252F#/activ. Ch. 9 Quiz 6 Saved Save & Exit Submit Human diploid cells have Multiple Choice eook 23 chromosomes 1 pair of autosomes 23 pairs of chromosomes 46 pairs of chromosomes 2 pairs of sex chromosomes Mc Graw Hill ENG 1124 AM 3/27/2022 O O O OO
Answer Space In the answer space on the right, draw in the chromosomes of cell A. Your drawing should show the usual result of the process of meiosis.
10
10 10 The yellow arrow indicates the structure that O forms the cleavage furrow. O organizes spindle fibers. O connects sister chromatids. O connects homologous chromosomes. eduction (1).ppt e Chapter 11-1 (1) ppt