10.18 Using the information in Figs. 10.14 and10.18, explain how the two oligonucleotides5'-CAAAGAAAAG-3' and 5'-CTTTTCTTTG-3'assemble into a double helical structure (see Fig.10.14 for the 3' and 5' numbering, and definitionsof C, A, G and T).Fig. 10.18. Two strands of oligonucleotides sequenced5-CAAAGAAAAG-3' and 5'-CTTTTCTTTG-3' assemble into adouble helix. The structure has been determined by X-ray diffraction[M. L. Kopka et al. (1996) J. Mol. Biol., vol. 334, p. 653]. Thebackbone of each oligonucleotide is depicted as an arrow pointingtowards the C3' end of the sequence, and the nucleobases are shown ina 'ladder' representation. The nucleobases are colour coded: G, green;A, red; C, purple; T, turquoise. to next sugarto next sugarH.p=0N-H IIOMe5'N H-Nto nextphosphateto nextphosphateAdenine-thymine (A-T) base pairto next sugarto next sugarO.HO H-N= nucleobaseN-H IN(A, T, G or C)to nextphosphateN-H Oto nextHphosphateGuanine-cytosine (G-C) base pairFig. 10.14. The left-hand diagram shows two units in one strand of DNA; DNA is composed of condensed deoxyribonucleotides and the fourpossible nucleobases are adenine (A), guanine (G), cytosine (C) and thymine (T).The right-hand diagrams illustrate how complementary base pairs in adjacent strands in DNA interact through hydrogen bonding. (See alsoFig. 10.18.)

Deoxyribonucleotides are the building blocks of DNA. Each nucleotide is composed of five carbon…

Answered: 10.18 Using the information in Figs.…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

For the trinucleotide 5’ G-C-A-3’ How many nucleotide subunits are present in its ‘backbone’? How many nucleotide ‘non-backbone’ subunits are present? How many phosphodiester linkages are present? What is the overall charge carried by the trinucleotide?
Given the structures of the ribonucleotides as (shown in Image A) and deoxyribonucleotides (as shown in Image B), Draw the structure of the polyribonucleotide UAGCCUG and the structure of thepolydeoxyribonucleotide CGTAGAT.
Low-resolution X-ray diffraction analysis of a protein composed of long stretches of the sequence (-Gly-Ser-Gly-Ala-Gly-Ala-)n, where n indicates any number of repeats, shows an extended structure of stacked layers, with a repeat distance between layers that alternates between 3.5 Å and 5.7 Å. Propose a mođel that explains this scenario. 5. The right-hand panel in the linked figure shows sedimentation equilibrium analytical ultracentrifugation data for a mixture containing equimolar amounts of two fibrous proteins, Vps27 and Hsel. The blue circles are the data and the black line is the expected plot for a monodisperse 1:1 Vps27:Hsel complex of 23.7 kDa. In the left-hand panel, data is shown for Vps27 alone. The black line represents the expected curve for monomeric Vps27. Both experiments were run under identical conditions (same buffer, same spinning speed etc.) and the proteins have the same partial specific volume.
Shown below are two cartoon views of the small globular protein StrepG inwhich an α helix is packed against a four-strand β sheet. The sheet is madeup of two “β-hairpins” (a β-hairpin is a “β-turn-β” structure). Refer to theimages and answer the questions that follow: (a) Identify the locations of the N- and C-termini of StrepG.(b) Indicate the orientation of the helical macrodipole, showing the (δ+)and (δ-) ends of the macrodipole.(c) How many residues are in the helix?(d) Do you predict that the α helix and β sheet are amphiphilic or not?Briefly explain.(e) The following two peptides are part of the primary sequence of StrepG.Based on your answer to part (d), which one is more likely to correspondto the α helix? Which is most likely to be part of a β-hairpin? Explainyour choice.Peptide #1: DAATAEKVFKQYAND or Peptide #2: VDGEWTYDDATKTFTV
If a polyribonucleotide contains equal amounts ofrandomly positioned adenine and uracil bases, what proportion of its triplets will encode (a) phenylalanine, (b)isoleucine, (c) leucine, (d) tyrosine?
1. Consider the following α helix from myoglobin at pH 7. Gln-Gly-Ala-Met-Asn-Lys-Ala-Leu-Glu-His-Phe-Arg-Lys-Asp-Ile-Ala-Ala-Lys-Tyr(a) Label amino acids in the polypeptide above as follows: p for polar and uncharged, np for non polar, – for negatively charged, and + for positively charged.(b) How many complete turns are there in this helix?(b) Which side chains are likely to be on the side of the helix that faces the aqueous solvent? Why?(c) Which side chains are likely to face the interior of the protein? Why?
For each polypeptide derived in the following sequences: 5' CAA GAG GUA UCC UAC AGA 3' 5' GUC AUC UGG AGG GGC AUU 3' 5' CUA UGC AGU AGG ACA CCC 3' 1. Draw the structure of each polypeptide. 2. Label the amide bonds. 3. Identify the N-terminal and C-terminal amino acids. 4. Write the name of each polypeptide.
Estimate the length, in nm, of the four identical beta-strands drawn in blue in panel (B) of the image below, if they consists of only the amino residues of the two alpha-helices highlighted in purple in panel (A) of the image below. Assume that the amino acid residues of the two alpha-helices combined were folded in four beta-strands of identical length.
Give two reasons to explain why a proline residue in the middle of an αhelix is predicted to be destabilizing to the helical structure.
Given the polypeptide chain below: Ala-Arg-Val-His-Asp-Gln 1. What is the N-terminus? 2.What is the C-terminus?
5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU UCC Leu UCA UCG U UUC UUA UUG CUU C CUC CUA CUG AUU A AUC AUA AUG U GUU G GUC GUA GUG CCU Leu CCC CCA CCG ACU lle ACC ACA Met ACG GCU Val GCC GCA GCG с Second Letter Ser Pro Thr Ala UAU UAC A | AAU AAC AAA AAG GAU GAC GAA GAG Tyr CAU CAC CAA Gin CAG 1 UAA Stop UGA Stop A UAG Stop UGG Trp G His Lys UGU UGC Asp Glu G 3rd Asn AGU Ser U letter AGC AGA AGG Cys U CGU CGC Arg CGA CGG GGU GGC GGA GGG DCAG DUAG DUCAG Arg Gly UCAG
Polylysine adopts a random structure in solution at physiological pH (i.e. 7.4). Given that the e-amino group of lysine has a pKa of 10.5, under what circumstances do you think polylysine will form an a-helix? Give an explanation for your decision. Given the pKa of the side-chain COOH group, under what circumstances would you anticipate polyglutamate to form an a-helix?

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS

10.18 Using the information in Figs. 10.14 and 10.18, explain how the two oligonucleotides 5'-CAAAGAAAAG-3' and 5'-CTTTTCTTTG-3' assemble into a double helical structure (see Fig. 10.14 for the 3' and 5' numbering, and definitions of C, A, G and T).