Q: Based on the chromatograms, Symmetry C18 (top) is less selective than Symmetry Shield RP18 (bottom)…
A: In general, Symmetry Shield RP18 columns feature Water patented embedded polar group technology that…
Q: What is 2D gel electrophoresis
A: 2D gel electrophoresis is a technique for detection and separation of proteins. It is a combination…
Q: Identify an example of initiation. A) homolytic cleavage B) heterolytic cleavage hydrogen…
A: We know that Initiation reaction : initiation step is a reaction in which radicals are formed…
Q: kindly prepare an assignment on Application of HPLC in Drug Analysis: one page show name of the…
A: In high-performance liquid chromatography (HPLC) we inject the sample, which is in solution form,…
Q: Briefly explain how anodic stripping analysis is able to be used for quantifying DNA
A: Cathodic or anodic stripping voltammetry have been used for a highly sensitive determination of…
Q: 1. An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show…
A:
Q: The maximum safe [Ba2+]=1.5x10-5M. Maintaining 1.0x10-3M levels for each of the anions below would…
A: Given: Maximum safe concentration of Ba2+ = 1.5 × 10-5 M. And the concentration of anion = 1.0 ×10-3…
Q: Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give…
A: In DNA sequencing, A compliments T whereas G compliments C ( Chargaff Rule). The formula for…
Q: Use the equations of the lines plotted in regards to the data pictured to determine Km and Vmax in…
A: A question based on Michaelis-Menton equation, which is to be accomplished.
Q: what ins the major Beduct PH = 4.5
A: To find major product
Q: N-number: A protein has a molecular mass of 400 kDa when measured by size-exclusion dodecyl sulfate…
A: Given information,MW given by size exclusion chromatography = 400 kDaIt is the native protein size.…
Q: 2. What types of species can be separated by RP-HPLC and not GLC? Please explain your answer and…
A:
Q: Which of the following statements is true regarding liquid liquid extraction for sample's…
A: Liquid-liquid extraction is a technique used for the separation of analyte from a liquid mixture.…
Q: Define the following terms used in HPLC: (a) gradient elution (b)…
A: Given terms, (a) gradient elution (b) isocratic elution (c) reversed-phase packing
Q: the % retention of the unnatural base pair drops from 100% to ~50% over the course of 75 hours after…
A: At the development of the hereditary letters in order of DNA, a few unnatural third base sets…
Q: A protein consists of two types of peptide chains (A and B) with an unknown stoichiometry (AxBy).…
A: Given that: peak area of A = 500,000 peak area of B = 100,000 molecular mass of A = 25,000…
Q: ou obtained the following raw data when setting up a Biuret standard curve: BSA (mg/ml)…
A:
Q: What is the difference between Mohr and serological pipette?
A: Difference between Mohr and serological pipette is given below.
Q: Define, explain and elaborate
A: The heat of reaction, the amount of heat that must be added or removed during a chemical reaction in…
Q: Jacqueline isolated an interesting new protein from the broth of a yeast culture. After purification…
A: Proteins are firmed by the amino acids with a peptide linkages among them. A peptide linkage will…
Q: 3. There is a class of polyesters that have the general structure shown below. . For example, in…
A: The equation which relates the number average molecular weight and glass transition temperature is…
Q: Biuret Assay accurately quantify protein concentration within the range of 5-150 mg/mL. JUSTIFY THE…
A:
Q: Which most accurately describes what the diagram below represent? Reflected light Incident light…
A: It's a Schematic diagram of an SPR based genosensor. The incident polarized light is coupled by a…
Q: Explain why the LC-MS-MS method is superior to the peptide mass mapping method.
A: Peptide mass fingerprinting (PMF) is an analytical technique for protein identification in which the…
Q: For the TLCS shown below, both plates have the exact same materials spotted on each lane (that is,…
A: Thin layer chromatography.
Q: ttering technique. If the formulation of the subject sample has included surfactants or salt…
A: The size of small particles in solution or in suspension is determine by the light scattering…
Q: The following figure indicated the separation 5-hydroxymethylfurfural (HMF), patulin (PAT),…
A: To predict the order of polarity of the given compounds.
Q: what are advangtage and disadvantage of using an Atomic Force Microscopy and explain each
A: Atomic force microscopy is a technique by which we study the different type of surfaces like…
Q: prepare an assignment on Application of HPLC in Drug Analysis(Amiloride): one page show name of the…
A: We have to prepare an assignment on application of HPLC in Drug Analysis showing name, dosage form,…
Q: b) Compound 2 Mass Spec 100- IR 80- 60 - 40- ce 20 - 1 1221 4 84 219 14 2126 1700 LJ6I 20 1156 20 92…
A: The solution of the question is given below:
Q: The following are the methods for visualizing spots in TLC chromatogram EXCEPT Choices:…
A: Thin layer chromatography or TLC is a chromatographic technique which is used to separate the…
Q: Solubility of BaF2 at 20 C0 = 0.161 gm / 100ml in water , calculate Ksp ? M.Wt of BaF2 = 137.34 + (2…
A:
Q: DELFIA® (Dissociation Enhanced Lanthanoid Fluorescence Immunoassay) is a time resolved fluorescence…
A: DELFIA is defined as Dissociation-Enhanced Lanthanide Fluorescent Immunoassay which is a…
Q: Briefly explain how cation exchange chromatography can used in protein separation?
A: Cation exchange chromatography is a form of ion exchange chromatography (IEX), which is basically…
Q: In proteomics, peptidomics (and the other -omics techniques), hyphenated MS techniques are used, and…
A: Since you have asked multiple questions, we will solve first one for you. For remaining questions,…
Q: what is the resolution
A: Resolution measures the number of pixels in a digital image or display. It is defined as width by…
Q: Consider a mixture comprised of the following proteins below: Protein i MW (kDa) Charge (pH 7.4)…
A: A question based on analytical separation that is to be accomplished.
Q: ind the isoelectric and zwitter ion of lysine, show the steps
A: Given the isoelectric and zwitter ion of lysine
Q: relative error caused by this deviation for each measu
A:
Q: or non provid- a) PCI- c) OF
A: This question is related to Lewis structure.
Q: Solubility of BaF2 at 20 C0 = 0.161 gm / 100ml in water , calculate Ksp ? M.Wt of BaF2 = 137.34 + (2…
A:
Q: Reason why a reference material must be analysed side by side with the sample in in DSC analysis
A: Differential Scanning colorimetry (DSC) is a technique to determine the temperature and heat flow…
Q: If inhibitor X changes lactase activity to a Vo of 0.10 mM per minute when [S] = 1.0 mM, and a Vo of…
A: Given: Reaction velocity (V0)1 = 0.10 mM/min [S]1 = 1.0 mM Reaction velocity (V0)2 = 0.133333 mM/min…
Q: Based on the given preparation procedure, identify THREE mistakes that were made.
A: High-performance liquid chromatography (HPLC) is a more enhanced chromatography with a large…
Q: (b) Protein concentration can also be determined by UV spectrophotometry. (i) Describe the principle…
A: Answer. UV spectrophotometry or UV-Visible spectroscopy is an analytical technique used to identify…
Q: Help me.... Explain the principles of gel permeation chromatography in Polymer, what is the…
A: Gel permeation chromatography is a powerful analytical technique used to separate dissolved…
Q: How can the mass transfer "C" term be reduced? a. increase the flow rate b. reduce the size of the…
A: In chromatography, The resistance presented during the mass transfer in between the mobile and…
Q: How do you find the Ksp and solubility limit for SrSO4 given [Sr]=0.000583095 & [SO4]=0.000583095?
A:
Q: Descriptives Bronchial reactivity 95% Confidence Interval for Mean Lower Bound Upper Bound Minimum…
A:
Q: The migration distances r, for each of the proteln standards bands and that of the unknown protein…
A:
Step by step
Solved in 3 steps with 2 images
- You perform a ligand binding assay using a newly isolated protein with its natural ligand and plot the resulting data. 1.0 Use the graph of bound ligand fraction (Y) versus ligand concentration ([ligand) to estimate the dissociation constant (Ka) and the association constant (K,). 0.75 > 0.5 0.25 0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0 (ligand) (M) 0.10 Ka = K. - 10 M- incorrect IncorrectWhich of the following is equivalent to the overall concentration of Mg-EDTA near the endpoint? a. [Mg2+] [EDTA2-] b. [Mg-EDTA] / {[Mg2+] [EDTA2-]} c. {[Mg2+] [EDTA2-]} / [Mg-EDTA] d. {[Mg-EDTA][Ind2-]} / {[Mg-Ind] [EDTA2-]}Colorimetric reagents. Proteins will intensely absorb 280 nm light even in the absence of a colorimetric reagent (See figure). Why is it advantageous to use the Bradford reagent to measure protein concentration rather than just measuring protein absorbance (280 nm) directly?
- If you have an octahedral site (Coordination Number 6). What is the minimum rcation/ranion? Prove your answer.I did not understand soultion for the question.. The relationship between Affinity and Association & Dissociation Constant. Four proteins (A-D) all bind the same ligand (X), with different affinities. For protein A & B we know that they have a binding site for X with a Kd (dissociation constant) of 10⁻⁵and 10⁻⁸ M, respectively. For protein C and D we know that they have a binding site for ligand X with a Ka (association constant) of 10³and 10⁵M, respectively. Which protein has the highest affinity for ligand ? Explain your reasoning. How do you make them all in same constant so that values can be compared and the one with highest Ka or lowest Kd (Highest affinity in both cases) can be ruled out.What is the difference between optical activity/polarimetry vs. (R)/(S) configurations? (+) seems to be clockwise, while (-) seems to be counterclockwise. (R) seems to be clockwise when the lowest priority group is facing the back, while (S) seems to be counterclockwise. Does (R) match up with (+) and (S) match up with (-)? If not, what is the difference? Is it that (R) and (S) are just how we determine the priorities in space while (+) and (-) can be determined via labaratory experiments? How can (R)(-) or (S)(+) exist then? Would this show that the spatial arrangement is incorrect in comparison with what the polarimeter shows?
- What is the value of the asymmetry term for 135Ba in the binding energy formula of the liquid drop model? Select one: O a. O b. O c. -55.72 MeV e. -64.78 MeV -105.43 MeV O d. -91.22 MeV -83.76 MeVCengage Learnin ✓ Cengage Learnin ✓ Cengage Learnin OWLv2 | Online ✓ b Cengage Learnin what are the unit X ChatGPT Buy iPhone 15 a ✓ prod03-cnow-owl.cengagenow.com/ilrn/takeAssignment/takeCovalentActivity.do?locator-assignment-take Ex3 CH 14 and 15 [References] Question 1 1 pt This question has multiple parts. Work all the parts to get the most points. Question 2 1 pt Question 3 × 2 pts Question 4 2 pts Question 5 1 pt Question 6 × 2 pts Question 7 1 pt mol/L Sulfuryl chloride, SO2 C12, is a compound with very irritating vapors; it is used as a reagent in the synthesis of organic compounds. When heated to a sufficiently high temperature, it decomposes to SO2 and Cl₂. SO2Cl2(g) SO2(g) + Cl2(g) Kc = 0.045 at 375°C a An 1.00-L flask containing 6.95 g of SO2 Cl2 is heated to 375 °C. What is the concentration of SO 2 Cl 2 in the system when equilibrium is achieved? Concentration = Question 8 2 pts Submit Question 9 1 pt Question 10 2 pts Submit Answer Try Another Version 3 item attempts…1. It measures how good chiral molecules are able to rotate plane, polarized light. A. Specific rotation B. Index of refraction C. Optical activity D. Specific gravity 2. What is the Rf value of the sample if the distance travelled by the solute is 93.5mm and the distance travelled by the solvent is 99.2mm? A. 0.94 mm B. 1.06 C. 0.94 D. 1.06 mm 3. LAL test results could be determined based on ________? I.Color development II. Cloudiness III. Gel clot formation A. I and II B. II and III C. I and III D. I, II, and IIJ 4. Thiamine is assayed by? I. Spectrophotometry II. Fluorometry III. Turbidimetry A. I, II, and III B. I only C. II only D. I and II only
- Based on the chemical reactions provided, which of the following is equivalent to KMg-Ind? a. [Mg2+] [Ind2-] b. [Mg-Ind] / {[Mg2+] [Ind2-]} c. {[Mg2+] [Ind2-]} / [Mg-Ind] d. {[Mg-EDTA][Ind2-]} / {Mg-Ind] [EDTA2-]}20. In current-sampled polarography the polarographic wave of which metal ion will appear first? Pb (E% = -0.4 V) Cd (E% - -0.6 V) O Zn (E% = -1.0 V) Cu (E% - +0.02 V)Q2. What is the number of IR and Raman active bands in the following molecules? a. NH b. [Co(NH3)]= c. [Co(Cl) Brs] d. [Ni(CO)4] Good Luck