Q: Explain the process of Designing a Multistep Synthesis
A: Chemical synthesis refers to artificial means to carry out reactions in the lab using suitable…
Q: Polyethylene is made up of the following fractional distribution. Fraction Molecular Weight (Da)…
A: Since you have posted a question with multiple sub-parts, as per our company guidelines we are…
Q: What is 2D gel electrophoresis
A: 2D gel electrophoresis is a technique for detection and separation of proteins. It is a combination…
Q: Are the number of spots shown on SDS-PAGE electrophoresis dependant on whether the protein is a…
A: It is to explain that whether the number of spots shown on SDS-PAGE electrophoresis is dependent on…
Q: What is chiral chromatography?
A:
Q: A student has a purple dye mixture on which she performs a TLC experiment with a silica gel plate…
A: TLC experiment is performed on the mixture of purple dye with the help of silica gel plate and…
Q: Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give…
A: In DNA sequencing, A compliments T whereas G compliments C ( Chargaff Rule). The formula for…
Q: What are the different technical considerations in performing the serum protein electrophoresis…
A: Answer - The serum protein electrophoresis (SPEP) test measures specific proteins in the blood to…
Q: Differentiate between isocratic elution and gradient elution. Why is gradient elution sometimes a…
A:
Q: During the experiment, a student calculated the R¡value for glutamic acid of 0.29 and 0.45 for…
A: Chromatography is defined as the laboratory technique for the separation of components of a mixture…
Q: A protein consists of two types of peptide chains (A and B) with an unknown stoichiometry (AxBy).…
A: Given that: peak area of A = 500,000 peak area of B = 100,000 molecular mass of A = 25,000…
Q: ou obtained the following raw data when setting up a Biuret standard curve: BSA (mg/ml)…
A:
Q: This is an output from an HPLC experiment. The column was packed with extremely hydrophobic grains.…
A: HPLC High performance liquid chromatography . This technique is based on the adsorption by which the…
Q: For GC analysis, the following can cause band broadening and poor resolution OUse of automatic…
A: Chromatography is separating technique for mixtures into it's components. It is based on the…
Q: What is the difference between Mohr and serological pipette?
A: Difference between Mohr and serological pipette is given below.
Q: In a mixture of the five proteins listed below, which should elute second in size- exclusion (gel-…
A: Size Exclusion Chromatography : It is a chromatographic method in which the components of the…
Q: How resolution in HPLC analysis can be improved?
A: HPLC i.e high-performance liquid chromatography is an analytical method which is being used to…
Q: A student
A: she gets a R of 0.69 and for the red spot, she gets a R of 0.45from the given data she analyses that…
Q: how would you isolate the glycosylated insulin from the unglhcosylated forms? can you come up with a…
A: In general, Insulin helps keep the glucose in your blood within a normal range by taking glucose out…
Q: Analysis of protein purity using two-dimensional electrophoresis could involve
A:
Q: For the TLCS shown below, both plates have the exact same materials spotted on each lane (that is,…
A: Thin layer chromatography.
Q: 1. You know that these types of compounds can be analyzed by either GC or HPLC but you are told by…
A: GC can only apply to analyse volatile substance while HPLC can handle any soluble compound…
Q: what are advangtage and disadvantage of using an Atomic Force Microscopy and explain each
A: Atomic force microscopy is a technique by which we study the different type of surfaces like…
Q: How does ammonia, dimethylglyoxime (DMG), and 8-hydroxyquinoline (8HQ) interact with your cations,…
A: In paper chromatography, substances are distributed between a stationary phase and a mobile phase.…
Q: Which mechanisms of band broadening that operate in chromatography are absent in capillary…
A: The process of band broadening is basically explained by the Van Deemter equation in chromatography…
Q: If a polystyrene sample gave a number average molecular weight of 300,000 Dalton and a…
A: Polydispersity index can be denoted by symbol PDI.
Q: Why does a molecularly imprinted polymer selectively bind a desired analyte?
A: Molecularly imprinted polymer selectively bind a desired analyte has to be explained.
Q: Define the following terms used in HPLC: (d) sampling loops (e)…
A: The following terms used in HPLC can be defined as :
Q: The mass of a protein was determined to be 92.7 kDa using matrix assisted laser…
A: The relation between kDa (Kilodalton) and Kg (Kilograms) 1 kDa = 1.661 × 10-24 kilogram By using…
Q: Both UV/Vis and IR spectrometers can be used for quantitative analysis of analytes. True False
A: Given question is multiple choice question That is : Both UV/Vis and IR spectrometers can be used…
Q: the efficiency of a chromatographic column improves the measure that a.increases the height of the…
A: To determine what improves the efficiency of a chromatographic column:
Q: The resulting retention volumes for a series of polystyrene standards Molar mass (g/mol) Retention…
A: Given: Molar mass (g/mol) log(Mw) Retention volume (mL) 640000 5.80618 12.14 483000 5.683947…
Q: Which of the following is a real limitation to Beer’s law? Analyte at high concentrations…
A: Beer's law is defined as absorptive capacity of dissolved solute is directly to the concentration of…
Q: TGA analysis
A: Ans. Thermogravimetric analysis or TGA techniques helps in determination of thermal stability of…
Q: calculate Rfs for each spot on your chromatogram
A: Retention factor is equal to the ratio of distance travelled by solute divided by the distance…
Q: Use the following chromatogram of standard amino acids: 24 45 16 19 21 12 15 23 13 14 18 10 12 14 16…
A: To determine the retention time of peak 4 from the given chromatogram.
Q: You obtained the following raw data when setting up a Biuret standard curve: BSA (mg/ml) 0 1 2 3 4 5…
A:
Q: You have a mixture of 100 proteins with molecular weights between 30 and 45 kDa. All proteins in the…
A:
Q: If it was discovered that a polyaromatic hydrocarbon (PAH) having a density of 1 g/cm3 has a…
A:
Q: Question 19 In AFM, what is the consequence of low scanning time? limited magnification thermal…
A: AFM refers to Atomic Force Microscopy or Scanning force Microscopy. It is a high resolution type of…
Q: The substances in the table below were chromatographed on a gel filtration column. Estimate the…
A: The molecular weight of the the unknown can be determined by plotting logarithmic value of molecular…
Q: In TLC, point of origin refers to O The bhottom edge of the TLC plnto.
A: Question 1: Option 1 is the correct answer. The point of origin was sketched very lightly with…
Q: What kind of chromatography would you for purification of full length antibody ?
A: Chromatography is used to seperate and purify mixture of species . Various type of chromatrographic…
Q: How can the mass transfer "C" term be reduced? a. increase the flow rate b. reduce the size of the…
A: In chromatography, The resistance presented during the mass transfer in between the mobile and…
Q: 1. Describe the different types of analytes which can be analyzed using the different methods of…
A: Two questions based on Beer-Lambert law, which are to be accomplished.
Q: Purpose of quantitative transfer in experiments.
A: The dissolution of a solute in a solvent based on its solubility rule provides a solution. If the…
Briefly explain how anodic stripping analysis is able to be used for quantifying DNA
Step by step
Solved in 2 steps
- The negative ion mode electrospray ionization (ESI) mass spectrum of an oligonucleotide shows peaks at the following m/z ratios: 2903.8 (40%), 2580.9 (67%) , 2323.7 ( 100 % ) , 2111.4 (71%), and 1935.7 (38%). What is the molecular weight of this molecule? Please show your calculations and use all peaks to determine significant figures.What are analytes and how can they be used for biochemical recognition?Briefly explain how cation exchange chromatography can used in protein separation?
- The mass of a protein was determined to be 92.7 kDa using matrix assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS). Convert this mass to kilograms. mass: kg50 uL of an aqueous sample of double-stranded DNA is dissolved in 950 uL of water. This diluted solution has a maximal absorbance of 0.326 at 260 nm. What is the concentration of the original (more concentrated) DNA sample, expressed in ug/uL?Calculate the (a) Linearity constant (r), (b) y-intercept, (c) Slope, and (d) Protein content of an unknown sample having an absorbance of 0.325.
- 50 uL of an aqueous sample of double-stranded DNA is dissolved in 950uL of water. This diluted solution has a maximal absorbance of 0.326 at 260 nm. What isthe concentration of the original (more concentrated) DNA sample, expressed in ug/ul? I would like to know the process of this question. And I was wondering as well if the total diluted volume would be 950ul + 50ul = 1000ulChemistry Briefly describe the differences between the scanning and SIM approaches with reference to your data. Discuss how and why your scanning (TIC) and SIM (mass chromatograms look different. Pay particular attention to selectivity of compounds detected and signal-to-noise. What are some advantages of SIM? What are some disadvantages?what are advangtage and disadvantage of using an Atomic Force Microscopy and explain each
- Describe how to prepare adulterated palm oil samples before analysing it with Raman spectrometer. Also the describe the process how the Raman spectrometer will analyze the adulterated palm oil samplesTrue or False. 1. The absorbance of a sample is equal to the negative logarithm of the transmittance. 2. Winkler method of dissolve oxygen determination is an example of iodometry. 3. A diazo compound is produced when nitrite is reacted with sulfanilamide in acidic solution. 4. Atomic Absorption Spectroscopy can be used to analyze the functional groups of organic substances. 5. A diode array spectrometer use an absorption or interference filters for wavelength selection and a photoelectric device for measuring radiant power. 6. The oxidation state for the manganese in the brown solid which precipitate in Winkler method is +3 7. In Winkler method, the iodine produced is oxidized during sodium thiosulfate titration to iodide ion. 8. When the pH of the solution is adjusted to pH greater than 12, the EDTA reacts with magnesium ions only, because calcium precipitates as calcium hydroxide.One disadvantage of thin layer chromatography is that... it cannot be used for quantitative measurements. O it consumes large volumes of solvents O it cannot analyze volatile samples it cannot be used to analyze many samples simultaneously it requires a large amount of sample for analysis