mulation Activity ctivity, you will be provided with the DNA nucleotide ce that codes for a hypothetical protein. The code will ided to you in three fragments. You will have to tran- he code into mRNA, remove an intron segment, and e the mRNA into the protein. In addition, you will identify the beginning fragment, the middle fragment, end fragment. dure Opy each of the following quences onto a separate ece of paper. TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT Sequence B TCAGACGTTTTTGCCCCGTAACAACTTGTTACAA CATGGTCATAAACGTCAGAGATGGTCAATCTCTTAAT GACT Sequence C TACAAACATGTAAACACACCCTCAGTGGACCAACTC CGCA ACATAAACCAAACACCGCTCGCGCCGAAAAA GATATGG 2. Divide the sequences into triplets (codons) by putting a slash between each group of three bases. TIVITY 5.4.1 continued anscribe the DNA into mRNA. entify the middle, end, and beginning sequence. Use ur knowledge of start and stop codons to help you gure it out. move codons 24 to 66, including codon 66. anslate the mRNA into protein using the genetic de. sis hich fragment was the beginning fragment? How you know? hich fragment was the end fragment? How do you now? c) Codons 24 to 66 represent an intron. At what point in the process of protein synthesis are introns removed? What is the name of the enzyme responsible for this excision? (d) How many amino acids does this protein contain? (e) Is this genetic sequence eukaryotic or prokaryotic? How do you know? (f) If you worked backward, starting with the amino acid sequence of the protein, would you obtain the same DNA nucleotide sequence? Why or why not? (g) Provide the anticodon sequence that would build this protein.
mulation Activity ctivity, you will be provided with the DNA nucleotide ce that codes for a hypothetical protein. The code will ided to you in three fragments. You will have to tran- he code into mRNA, remove an intron segment, and e the mRNA into the protein. In addition, you will identify the beginning fragment, the middle fragment, end fragment. dure Opy each of the following quences onto a separate ece of paper. TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT Sequence B TCAGACGTTTTTGCCCCGTAACAACTTGTTACAA CATGGTCATAAACGTCAGAGATGGTCAATCTCTTAAT GACT Sequence C TACAAACATGTAAACACACCCTCAGTGGACCAACTC CGCA ACATAAACCAAACACCGCTCGCGCCGAAAAA GATATGG 2. Divide the sequences into triplets (codons) by putting a slash between each group of three bases. TIVITY 5.4.1 continued anscribe the DNA into mRNA. entify the middle, end, and beginning sequence. Use ur knowledge of start and stop codons to help you gure it out. move codons 24 to 66, including codon 66. anslate the mRNA into protein using the genetic de. sis hich fragment was the beginning fragment? How you know? hich fragment was the end fragment? How do you now? c) Codons 24 to 66 represent an intron. At what point in the process of protein synthesis are introns removed? What is the name of the enzyme responsible for this excision? (d) How many amino acids does this protein contain? (e) Is this genetic sequence eukaryotic or prokaryotic? How do you know? (f) If you worked backward, starting with the amino acid sequence of the protein, would you obtain the same DNA nucleotide sequence? Why or why not? (g) Provide the anticodon sequence that would build this protein.
Biochemistry
6th Edition
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Reginald H. Garrett, Charles M. Grisham
Chapter30: Protein Synthesis
Section: Chapter Questions
Problem 2P
Related questions
Concept explainers
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Topic Video
Question
please answer only the highlighted ones i don’t need the nonhighlighted ones and make sure it’s correct read the nonhighlighted questions so u can understand how to do the highlighted ones pls make sure it’s correct.
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by step
Solved in 3 steps
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Recommended textbooks for you
Biochemistry
Biochemistry
ISBN:
9781305577206
Author:
Reginald H. Garrett, Charles M. Grisham
Publisher:
Cengage Learning
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Biochemistry
Biochemistry
ISBN:
9781305961135
Author:
Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:
Cengage Learning
Biochemistry
Biochemistry
ISBN:
9781305577206
Author:
Reginald H. Garrett, Charles M. Grisham
Publisher:
Cengage Learning
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Biochemistry
Biochemistry
ISBN:
9781305961135
Author:
Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:
Cengage Learning