8. The following diagram illustrates a step in the process of translation. fMet Pro mRNA UAC GGG AUGCCCACG UAG a) Identify the following elements on the diagram. Aminoacyl site (A) Peptidyl site (P) Exit site (E) Amino end of the newly synthesized polypeptide chain Carboxyl end of the newly synthesized polypeptide chain Approximate location of the next peptide bond that will be formed
Q: Answer the following questions regarding the diagram (below) showing translation. The ribosome is…
A: “Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: What thoughts do you have on stigma & bias related to opioids, history of opioids, cause of…
A: The opioid crisis is a significant public health issue in the United States, with overdose deaths…
Q: Which of the following lists correctly prioritizes by importance (highest to lowest) the systems,…
A: Spatial orientation in flight refers to the ability of an organism to maintain its position and…
Q: If 80% of drunk drivers fail to pass a sobriety test (walking a straight line for 5 meters) in 60…
A: The objective of the question is to determine the specificity and sensitivity of a sobriety test…
Q: Researchers have found that the volume of the brain is_____ in older adults than in younger adults…
A: The size and measurement of the brain can be done by weight or volume via MRI scan, by skull…
Q: Describe the findings of figure 2A
A: Grasping the 16S r RNA Quality:The 16S ribosomal RNA (r RNA) quality is a fundamental part of the…
Q: Which of the following does NOT result from the malignant proliferation of plasma cells?…
A: The question is asking us to identify which of the given options is not a result of the malignant…
Q: Whisker number in a new breed of mouse is controlled by 2 genes. The line with no contributing…
A: When crossing an AaBb mouse with an AaBB mouse, the offspring can have four different genotypes:…
Q: Joe suffers from pernicious anemia because his body is unable to produce intrinsic factor. Which…
A: The question is asking us to identify the part of the digestive system that is not functioning…
Q: 4) Two membrane preparations have been made from the plasma membrane of erythrocytes (i.e red blood…
A: The data describes an experiment on two vesicle preparations derived from erythrocyte plasma…
Q: Please define each term in the figure Laser beam Vaporization Coagulation Carbonization Hyperthermia…
A: Laser innovation in therapeutic medicines, especially in surgeries, has revolutionized precision and…
Q: The Muslim scholar Abu Ali al-Hussain Ibn Abdullah Ibn Sina (Avicenna) made which of the following…
A: The objective of the question is to identify which scientific claim made by Avicenna could only be…
Q: Which of the following stains highlights iron deposits in cells? Question 10 options:…
A: The objective of the question is to identify the stain that is used to highlight iron deposits in…
Q: 3:09 1 Back Pulse permanvmuy turneu VII Question 27 (Mandatory) are an individual's set of specific…
A: Question 27: MHC (Major Histocompatibility Complex) is an individual's set of specific "self" marker…
Q: What effect does acidic cerebrospinal fluid have on respiration? A) Increases respiratory depth;…
A: A) Increases respiratory depth; increases respiratory rateThis is incorrect because, as explained…
Q: BF, a 37-year-old male, is scheduled for a same-day surgical procedure for hernia repair. He has no…
A: The objective of the question is to determine the ABO blood type of the individual named BF based on…
Q: GQ14
A: Transcription is a crucial mechanism in molecular biology that converts genetic information from DNA…
Q: Genetics Q9
A: The objective of the question is to identify the type of mutation that occurs when a DNA sequence…
Q: GQ11
A: The objective of this question is to determine the number of nucleotides required to make a protein…
Q: In corn, the genes that determine seed color and coat are both located on chromosome 9. Seed color…
A: This analysis of a corn dihybrid cross revealed that seed color and coat texture are controlled by…
Q: Welcome Biological Anthropology LabMore specifically, tell us which topic you are the most excited…
A: Approach to solving the question: Detailed explanation: Examples: Key references:
Q: If 85% of diabetic patients are correctly identified by a urine test for glucose, but 25% of…
A: The objective of the question is to determine the sensitivity and specificity of a urine test for…
Q: Briefly describe the overall message of figure 1C
A: Figure 1C presents a detailed depiction of the gene network associated with the gastrointestinal…
Q: Which month of the Roman year was recognized by the traditional first king of Rome (Romulus) as the…
A: The question is asking for the Roman month that was recognized by Romulus, the traditional first…
Q: Papua New Guinea is known for its rich biodiversity and unique ecosystem. Write an eassy exploring…
A: The objective of this question is to explore the environmental issues and conservation efforts in…
Q: Allowing all drunk-driving suspects (driving erratically) to complete the above sobriety test in 120…
A: The question is asking about the potential effects of extending the time allowed for a sobriety test…
Q: Need help with evolutionary biology problem
A: self-explanatory please give me a helpful rating if you are satisfied with the answer
Q: According to Jean Buridan’s equation, the momentum or “impetus” of an 88 kilogram mass moving at 5…
A: The objective of this question is to calculate the momentum or 'impetus' of an object with a given…
Q: Calculate the number of bacteria (CFU/ml) in each serum and saline sample. What was the purpose of…
A: Calculating CFU/ml in Serum and Saline SamplesTo calculate the number of colony-forming units per…
Q: Which of the following is true of ribozymes? Ribozymes sound like "enzymes" but do not have…
A: Ribozymes are RNA molecules or RNA–protein complexes that are catalytically active, with the…
Q: Which Roman Catholic Order is correctly matched with its favored metaphysical doctrine? the…
A: The objective of the question is to identify the correct match between a Roman Catholic Order and…
Q: Which phylum of bacteria are most frequently unregulated and downregulated in CF samples?
A: In cystic fibrosis (CF), dysbiosis, or an imbalance in the microbial community, occurs in the lungs,…
Q: Leukemic lymphoma is when Question 3 options: A) Lymphoma cells have…
A: Leukemic lymphoma refers to a condition where lymphoma, a type of cancer that originates in the…
Q: In Aristotle’s scala naturae, the entoma (insects, chelicerates, and other non-crustacean…
A: The objective of the question is to understand the classification of 'souls' that Aristotle assigned…
Q: According to current ideas about the DNA genetic code, which one of the following statements is…
A: The genetic code is the set of rules by which information encoded within genetic material (DNA or…
Q: Please solve question 2, Solve question 2 please. Solve question 2 first. Q1: Write down the best…
A: Connective tissue, ubiquitous in the body, offers structural support and cohesion to organs and…
Q: Q1: a. Write down the best way to examine epithelial tissues under microscope by what the stains…
A: a.Epithelial tissues are examined under a microscope using a staining technique called Hematoxylin…
Q: BC, a 25-year-old African American female, has presented to the emergency department at a local…
A: The objective of the question is to determine the ABO blood type of the patient BC based on the…
Q: What is the name of the disease caused by pneumococcal bacteria?
A: The objective of the question is to identify the disease caused by pneumococcal bacteria.
Q: Calculate the 2 possible values of x in this equation: x2 – 16x + 48 = 0, either by using the…
A: The objective of this question is to find the two possible values of x in the given quadratic…
Q: Station 6: The Miocene: Gigantopithecus Gigantopithecus, which means “giant ape”, has been found in…
A: The objective of this question is to compare the dental and jaw structure of Gigantopithecus, a…
Q: elect an electrolyte from the list in the document linked below. Using references that you may…
A: Electrolyte Imbalance: PotassiumThis response explores potassium, a crucial electrolyte, and the…
Q: In order for a cell to receive and respond to a particular extracellular chemical signal, it must…
A: Ans:- Correct ans is receptor
Q: Muhammad ibnu Abdillah, the traditional founder of Islam, recognized all of the following religious…
A: The question is asking us to identify which of the listed religious texts was not recognized as…
Q: What are noticeable characteristics of the Indri and how do their skelatons detail their locomotive…
A: The Indri, also known as the babakoto, is the largest living lemur species native to Madagascar.…
Q: GQ1
A: The objective of the question is to identify the enzyme that plays a crucial role in the process of…
Q: 25
A: The objective of the question is to understand the effect of a drug that inhibits DNA methylation on…
Q: How would most biologists and anthropologists explain the reasons behind why primates do specific…
A: Primate behavior is generally understood by scientists and anthropologists to be the consequence of…
Q: < 11:22 My Files Lecture13Activities U.pdf Superior vena cava Activity 2 Sheep Heart Dissection…
A: Picture 1 Labelling Picture 2 Labelling
Q: Classical Mendelian Genetics, Incomplete Dominance, Codominance, and Multiple Alleles 1. Complete…
A: In incomplete dominance,the genotype ratios differ from typical Mendelian ratios .Instead of the…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- The following segment of DNA in a hypothetical model organism encodes a polypeptide containingSEVEN amino acids. Pretend this short polypeptide is a completely functional enzyme. DNA tripletsencoding the translation initiation (or start) codon and a stop codon are included in the sequence.3 •GGGTACGATCGGAAAGTTGGTTCICCGGTATAGCTG5'5•CCCATGCTAGCCTTTCAACAAAGAGGCCATATCGAC.3'a. Label which of the DNA strands is the template strand and which is coding strand. b. Below, show sequence and the polarity of the mRNA encoded by this 'gene'. Determine theamino acid sequence of the polypeptide (use three letter codes for the amino acids) andidentify the N- and C- terminal ends of the polypeptide. please help. I am confused. c. Which of the 7 side chains in this polypeptide can form hydrogen bonds with polar molecules(like water)? Place a circle around these.d. Some amino acids on a polypeptide can be modified post-translationally. Thesemodifications may have some effect on the function of the…What polypeptides would be formed from the sequence UCAATGGGGUUUAUAGCG… (there are bases after the last G but we don’t know what they are so there may be some ambiguity for the last codon with regards to the amino acid possibilities) if the translation frame had UCA as the first codon: if the translation frame had CAA as the first codon: if the translation frame had AAT as the first codon:Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table . Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-Cys
- Using the given information, determine the correct order of the following events during translation: TRNA-methionine is cleaved and moves the empty tRNA to E site & is released, TRNA with polypeptide chain moves to P site. Second tRNA binds to 1. Step 1 codon in A site 2. Step 2 Ribosome arrives at stop codon & polypeptide chain is released from TRNA 3. Step 3 4. Step 4 A peptide bond is created between the first amino acid and the second amino 5. Step 5 acid. 6. Step 6 TRNA-methionine binds to the start codon and the large ribosomal unit binds Small subunit scans MRNA until it reaches start codonAn RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP and GTP. When this RNA is used in an in vitro translation system, all of the following amino acids could be incorporated into a newly made polypeptide, except: Codon Table Second position C UUU UCU UAU UGU phe tyr сys UUC UCC UAC UGC ser UAA Stop UGA Stop UAG Stop UGG trp UUA UCA UUG UCG CUU CCU CAU CGU leu his ССС pro ССА CỤC САС CGC arg CỦA САА CGA gln CUG CCG CAG CGG AUU ACU AAU AGU asn ser AUC ile ACC thr АCА AAC AGC AUA AAA lys AAG AGA arg AUG met ACG AGG GUU GCU GAU GGU asp GUC GCC ala GCA GẠC GGC val gly GUA GAA GGA glu GUG GCG GAG GGG glycine (Gly) histidine (His) proline (pro) alanine (Ala) arginine (Arg) Third position (3'-end) AGUCAG First position (5'-end)Determine the sequence of amino acids specified by the codons in the following information strand. AGG TCT TCA GGG AAT GCC TGG CGA GAG GGG AGC AGC TGG TAT CGC TGG GCC САА Then determine the sequence of amino acids if an insertion occurred to the left of the first adenosine and changed the reading frame as shown below. Notice that (1) the insertion is shown on the left by the lower-case “i", and (2) the bases are still in the same sequence; they are just shifted so that they are read differently. IAG GTC TTC AGG GAA TGC СTG GCG AGA GGG GAG CAG СTG GTA TCG CTG GGC CCA Suppose a single-nucleotide polymorphism occurred in the original strand to make the change shown below. Would this affect the resulting protein? Explain. This is the original strand AGG TCT TCA GGG AAT GCC TGG CGA GAG GGG AGC AGC TGG TAT CGC TGG GCC CAA This is the strand with the SNP. (The change is shown in red.) AGG TCT TCA GGG AAT GCC TGG CGA GAG GGG AGC AGC TAG TAT CGC TGG GCC САА Suppose a different single-nucleotide…
- Determine the sequence of amino acids specified by the codons in the following information strand. AGG TCT TCA GGG AAT GCC TGG CGA GAG GGG AGC AGC TGG TAT CGC TGG GCC САА Then determine the sequence of amino acids if an insertion occurred to the left of the first adenosine and changed the reading frame as shown below. Notice that (1) the insertion is shown on the left by the lower-case "i", and (2) the bases are still in the same sequence; they are just shifted so that they are read differently. IAG GTC TTC AĞG GAA TGC CTG GCG AGA GGG GAG CAG СTG GTA TCG CTG GGC ССАDraw a schematic of translation. Include the following: • 5'and 3'of MRNA nucleic acid • N and C of peptide A, P, E sites • The mRNA should be AUGCACUACAUU • There should be a peptide bond formed between the first two amino acids but that's it. Codons Found in Messenger RNA Second Base U A G Phe Ser Тyr Tyr Stop Stop Phe U Leu Ser Cys Ser Leu Ser Trp Leu Pro His Arg Arg Arg Arg Leu Pro His Leu Pro Gln Leu Pro Gln lle Thr Asn Ser A lle Thr Asn Ser lle Thr Lys Arg Met Thr Lys Arg Asp Gly Gly Gly Gly Val Ala Val Ala Asp G Val Ala Glu Val Ala Glu Third Base UCAG UCAG UCAG UCAG First BaseConsider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?
- An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP and GTP. When this RNA is used in an in vitro translation system, all of the following amino acids could be incorporated into a newly made polypeptide, except: Codon Table Second position A G UUU UCU UAU UGU phe tyr сys UUC UCC UAC UGC ser UAA Stop UGA Stop A UAG Stop UGG trp UUA UCA UUG UCG CUU CCU CAU CGU leu ССС pro his CAC CUC CGC arg CỦA ССА CAA CGA gln CUG CCG CAG CGG AUU ACU AAU AGU asi se ACC thr ACA AUC ile AAC AGC AUA AAA lys AAG AGA arg AUG met ACG AGG GUU GCU GAU GGU asp GGC gly GGA GUC GCC ala GCA GAC val GUA GAA glu GAG GUG GCG GGG proline (pro) histidine (His) O arginine (Arg) alanine (Ala) glycine (Gly) Third position (3'-end) First position (5'-end)Consider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’ If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation. Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-TyrThe following diagram illustrates a step in the process of translation. Identify the following elements on the diagram. a. Approximate location of the next peptide bond that will be formed