Microbiology Fundamentals: A Clinical Approach
3rd Edition
ISBN: 9781259709227
Author: Marjorie Kelly Cowan Professor, Heidi Smith
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 15, Problem 6Q
You perform a lumbar puncture on a patient with meningitis symptoms and see that the spinal fluid is cloudy. However, panbacterial PCR comes up with nothing. What is a likely explanation?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A urine sample has been obtained, and the bacteria in this sample were cultured.
To obtain more information regarding the identity of this Gram-negative strain, Sanger sequencing can be used. A bacterial colony is transferred into a 0.2 mL tube containing buffer, then boiled to break open the bacterial cells. The tube is centrifuged, and some of the supernatant is transferred to a PCR tube. Next, the following reagents are added: DNA polymerase, a primer that binds near the 16S rRNA region of the bacterial chromosome, dNTPs, and fluorescently-labeled ddNTPs. The sequencing reaction is processed in a thermocycler, then analyzed by capillary electrophoresis. This experiment generates the following results (in FASTA format):
> sequencing results TAACAGGAAGCAGCTTGCTGCTTTGCTGACGAGTGGCGGACGGGTGAGTAATG TCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATAC CGCATAACGTCGCAAGCACAAAGAGGGGGACCTTAGGGCCTCTTGCCATCGGA TGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACG…
Explain briefly : (a) PCR
Explain how PCR/OLA (polymerase chain reaction/oligonucleotide ligation assay) can be used in the diagnosis of sickle cell disorder . Would you recommend this method for routine diagnosis of sickle cell disorder? Explain
Chapter 15 Solutions
Microbiology Fundamentals: A Clinical Approach
Ch. 15.1 - Prob. 1AYPCh. 15.1 - Provide a one-sentence description for each of...Ch. 15.2 - Identify factors that may affect the...Ch. 15.2 - Prob. 4AYPCh. 15.2 - NCLEX PREX 1. An RN is training a new staff nurse...Ch. 15.2 - NCLEX PREX 2. A clinical form used to report data...Ch. 15.3 - List at least three different tests that fall in...Ch. 15.3 - Prob. 6AYPCh. 15.3 - Discuss two major drawbacks of phenotypic testing...Ch. 15.3 - Q. What technique in this chapter do most home...
Ch. 15.3 - NCLEX PREX 3. When determining the clinical...Ch. 15.4 - Define the term serology, and explain the...Ch. 15.4 - Identify two immunological diagnostic techniques...Ch. 15.4 - Prob. 2MMCh. 15.5 - Explain why PCR is useful for infectious disease...Ch. 15.5 - Name two examples of techniques that employ...Ch. 15.5 - Explain how whole-genome sequencing can be used...Ch. 15.5 - Prob. 13AYPCh. 15.5 - Prob. 3MMCh. 15.6 - Describe the benefits of lab on a chip...Ch. 15.6 - Prob. 15AYPCh. 15 - When using pulsed-field gel electrophoresis,...Ch. 15 - Explain why it is possible to identify some...Ch. 15 - Serotyping identifies distinct members of the same...Ch. 15 - Prob. 4QCh. 15 - Name some bacterial structures that might be...Ch. 15 - You perform a lumbar puncture on a patient with...Ch. 15 - Which category of diagnosis is represented by...Ch. 15 - Write a paragraph that explains the mycobacterial...Ch. 15 - You inoculated a biochemical test strip with a...Ch. 15 - Prob. 10QCh. 15 - You perform a Kirby-Bauer disk diffusion test to...Ch. 15 - Why might culture conditions affect the results of...Ch. 15 - Which of the following techniques is most likely...Ch. 15 - Why is it more important to use selective media...Ch. 15 - What type of diagnostic method do you think would...Ch. 15 - T or F: Bacterial infection causes the expression...Ch. 15 - Prob. 17QCh. 15 - Prob. 18QCh. 15 - Prob. 19QCh. 15 - When PCR is performed by hand (not with a...Ch. 15 - What kind of a control would be important to run...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 1) Which technique is best suited to determining which genes are activated in a bacterium during infection while causing disease in a person. a) SDS-page b) microarray analysis c) RFLP analysis d) clone library analysis 2)Which of the following is not an application of PCR? a) Determine if two people are related. b) Identify a bacterial pathogen in a patient sample. c) Determine the gene sequence of the gene that codes for a bacterial enterotoxin. d) These are all applications of PCR.arrow_forwardWhy is it important to use a hyperthermophilic DNA polymerase in PCR? a) Because only hyperthermophiles have DNA polymerases. b) Because hyperthermophilic DNA polymerase is able to resist the saline reaction conditions. c) Because hyperthermophilic DNA polymerase is faster than other polymerases. d) Because hyperthermophilic DNA polymerase is able to resist denaturation at 95℃.arrow_forwardIf the PCR analysis of your sample did not work can you suggest why? How can you test if this is true?arrow_forward
- a) Which step of RT-PCR reactions does the figure shown below represents? b) Describe all enzyme(s) and name the molecule(s) that take part or are products of this step? Enzymes: Molecule 1: Molecule 2: Molecule 3:arrow_forward17) What gives Aspergillus sydowii colonies their hairy appearance? a) Hyphae () b) Stipes c) Growing media ) d) Ascocarpoda Jack has designed one primer which is complementary to the DNA of E. coli. He then used that primer for a PCR reaction using DNA isolated from a mixture of bacteria. He got no PC reaction product and hence concluded that there is absolutely no E. coli in the bacteria mixture. His conclusion is .... () True ) Falsearrow_forwardGive at least four(4) uses/application of PCR. Explain.arrow_forward
- PCR can be used __________. a) to increase the number of specific DNA fragments b) to modify the genome c) to obtain the sequence of the DNAarrow_forwardPlease answer these two questions regarding PCR: a) Why do you need to perform PCR on DNA obtained from a crime scene? b) Why so forensic labs analyze non-coding DNA rather than genes?arrow_forwardPCR has many useful applications. However, an incorrect application of PCR is: a) Amplification of any gene of interest from genomic DNA b) Screening various foods for genes that are typical in genetically modified organisms c) Identification of microbial DNA in a sample (viral or bacterial) d) Amplification of any protein of interestarrow_forward
- For what purpose is DNA fingerprinting used A) to sequence DNA from bacteria B) to separate DNA fragments C) to identify individuals who have committed crimes D) to identify single nucleotide polymerasearrow_forwardIf a uidA amplicon generateed by PCR is 200bp and the DNA fragments resulting from the restriction digest fall with 1000bp and 4000bp, which gel should be more concentrated? a) Higher concentration agarose b) Lower concetration agarose?arrow_forwardWhen we discussed microbiome analysis, we used a popular example in which you perform PCR using primers specific to a region of the 16S rRNA. This means that bacteria and archaea sequences will be represented in the PCR product and can be taxonomically assigned after deep sequencing, while eukaryotes will be excluded from the analysis. True Falsearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License