What is it? Leading chain Ligase procedure Replication fork T structure that may participate in translation The lagging chain
Q: What is the difference between -OH and OH-?
A: Introduction: The term hydroxide ion refers to OH group-containing negative charge present in…
Q: You apply a new drug to a different batch of neurons and record membrane potential changes in the…
A: Permeability barrier and semi permeability of cell membrane are both maintained by lipids. only…
Q: Which of the following compounds is not a TRUE ketone body? Acetoacetate All options are correct.…
A: To generate energy ketone bodies are used by cardiac and skeletal tissues. In starvation…
Q: When activated extracellularly, G protein-coupled receptors (GPCRs) initiate which of the following?…
A: Introduction: G-proteins referred to as guanine nucleotide-binding proteins, that are required for…
Q: What molecules participate in respiratory chain: Heme Coenzyme Q10 NAD FAD NADP
A: The respiratory chain catalyzes the transfer of the electrons to molecular oxygen accompanied with…
Q: Explain the chirality of amino acid molecules.
A: If any combination of rotations, translations, and conformational changes cannot superimpose a…
Q: How the different types of fats in one’s diet can help correct or prevent heart disease
A: Any ester of fatty acids, or a combination of them, is typically referred to as fat. These molecules…
Q: Order the following TCA cycle metabolites in the order they appear in the cycle. Not all answers…
A: Tricarboxylic acid or TCA cycle is also known as the Krebs cycle and is an important part of aerobic…
Q: Question 13 of 13 DNA A= 5' GGG GCT AGC CCC 3' DNA B= 3' ATA TAT ATA CCC 5' DNA C= 5' TAC GTT ACG…
A: DNA has two antiparallel strands of which one runs in 5'-3' direction and other in 3'-5' direction.…
Q: @write a detail note on citric acid Discuss mechalis menten equation. cyde.
A: Metabolic pathways that occur inside the cell are used to break down the large molecules into…
Q: 1. An aquaponics system is a system in which fish and plants are grown together. Shane Ahrens wanted…
A: "Since you have posted a question with multiple sub-parts, we will solve the first two subparts for…
Q: Multiple Choice Each of the numbered items or incomplete statements is followed by answers or by…
A: Indicators are dye molecules that are used to indicate the pH of a solution. Normality, molarity,…
Q: glucose-1-P axaloacetate lactate 11.E 10. E 9. P oxalcacetate Mitochondria NADH, FADH₂ glucose-6-P…
A: The different biochemical reactions are interrelated and the metabolic pathways involve multiple…
Q: Reaction mechanism of proteins, lipids, carbohydrates, nucleic acids
A: Proteins, nucleic acids, lipids and carbohydrates are frequently found in nature as lengthy…
Q: Which of the following enzymes functions in opposition of PFK, and therefore is inhibited by…
A: Glycolysis is a metabolic pathway through which glucose is converted into pyruvate and…
Q: Ketohexose sugars can form 8 different stereoisomers. How many of those isomers can be distinguished…
A: Carbohydrates are organic molecules arranged in form of aldehyde or ketones with multiple…
Q: List at least two (2) importance/applications of systematic separation of cations into groups in…
A: Cations are very crucial for the body and hence, their proper detection and identifying their…
Q: Which of the following statements is true about the control of muscle glycogen phosphorylase? a) It…
A: Introduction: Glycogen phosphorylase is a key enzyme that takes part in the first step of…
Q: What is the structural difference between the pentose sugars in DNA and RNA?
A: Pentose sugar is a five carbon molecule numbered as 1', 2', 3', 4' and 5'. When the functional…
Q: Item: Statement: a) Active site b) Induced fit c) Enzymes d) Enzyme-substrate complex 1. Decreases…
A: Metabolic activity is constant in living things. All live cells are constantly undergoing thousands…
Q: Do you think obesity is a choice? What are the influences of lipids/fats mechanism in the body to…
A: Lipids are vital micronutrient that helps our body to absorbs nutrients , made hormones, even cell…
Q: Consider the function of the cofactor FAD. Which of the following makes it unique (different) from…
A: Nicotine adenine dinucleotide NAD+ and flavin adenine dinucleotide (FAD+) are coenzymes that play…
Q: True or False In the presence of enzymes, the value of free energy of activiation (delta G°‡) for…
A: Enzyme: It is a biocatalyst that increases the rate of chemical reaction by lowering the the…
Q: Discuss three polysaccharide structural features that promote gel formation
A: Introduction: Polysaccharides are polymeric carbohydrate structures that are formed of repeating…
Q: Understanding membranes: a) Describe the factors that influence fatty acid melting temperatures…
A: The fluidity of membrane depends on the fatty acids present in it. Fatty acids form an integral part…
Q: ILLUSTRATIONS. For each of the given proteins: ● Draw the final location of the following proteins…
A: The process of transcription occurs in the nucleus following which the mRNA is translated in the…
Q: The following peptide is cut by serine protease enzyme Trypsin. How many fragments will be produced…
A: Proteases are enzymes which digest proteins by cleaving the peptide bonds. Trypsin is a protease…
Q: Explain in detail why fast-twitch fibers will use anaerobic respiration rather than aerobic…
A: Fast-twitch fibers are used for rapid bursts or intense movements while slow-twitch fibers are used…
Q: ou have a polypeptide chain that is linked by disulfide bond. If beta-mercaptoethanol is applied,…
A: A polypeptide chain that is linked by disulfide bond. If beta-mercaptoethanol is applied, there is…
Q: What covalent bonds are linking nucleic acid monomers? The bonds between oxygen and carbon…
A: Nucleic acids are made up of pentose sugar, nitrogenous base, and phosphate. Nucleic acids are…
Q: NSWER QUESTION A and EXPLAIN A protein was recently discovered to be located in the nucleus.…
A: Protein targeting the biological mechanism by which the proteins are transported to their…
Q: Glycogen was isolated from a liver sample. Sixty milligrams of the crude glycogen were then…
A: Sugars with reducing property (having aldehyde or keto group) are called reducing sugars. Some…
Q: Which among the following catalyse dehydration step in the TCA cycle ○ Isocitrate dehydrogenase O…
A: The acetyl CoA molecules synthesized through oxidative decarboxylation of pyruvate enter into the…
Q: In RNA OH group is present at 2¹ position
A: RNA has 2 -OH group attached to its carbon backbone, In Ribonucleic acid (RNA) The hydroxyl group…
Q: Q2) Yogurt is produced from milk by the action of diary bacteria. These bacteria produce lactic acid…
A: Yogurt is produced by a process called lactic acid fermentation. Lactobacillus Sp. and streptococcus…
Q: why do proteins get denatured under low temperatures? explain thoroughly
A: Amino acid content of protein is the primary structure of protein . Secondary structure is when…
Q: insufficient protein in the blood plasma
A: Edema in kwashorikar is basically due to insufficient protein in blood plasma which is albumin…
Q: Could someone please explain which sequence illustrates the order of the steps from food to…
A: Following digestion, the simpler compound produced is glucose, which would be metabolised to…
Q: Statement Analysis: Statement 1: In glycolysis, a molecule of glucose is degraded in a series of…
A: Glycolysis is the catabolic pathway in which Glucose is broken down to energy in the form of ATP.
Q: The top side of this figure offers more opportunities (for each base pair) that can lead to highly…
A: A single stranded nucleic acid is formed by joining the nucleotide units together through…
Q: Peptide 1: Peptide 2: NH₂ H₂N pro-ile-glu-arg N OH OH OH OH
A:
Q: METHOD: Pass a piece of bread around the house and let everyone in your house touch it. Then place…
A: Microbes are tiny living organism present everywhere around us. The microbial spores or endospores…
Q: Can we survive without carbohydrates and lipids? Explain your answer.
A: You most certainly can. However, there are ramifications. A no-carb diet eliminates almost all…
Q: pMDawn is digested with EcoR1, and BamHI. Resulting in fragments shown below: EcoRI: 20 kb BamHI:…
A: Agarose gel electrophoresis is a method of gel electrophoresis that is used to separate a mixed…
Q: All are both ketogenic and glucogenic amino acids except Group of answer choices Tyrosine Arginine…
A: Glucogenic amino acids are those that can be transformed to glucose through the process of…
Q: 47. Factors that influence alcohol use include peer pressure, family, and media messages. Answers A.…
A: Drug abuse is a rising concern all around the world, especially among teenagers. Several measures…
Q: phingolipids may contain Group of answer choices 1. glucose 2. glycerol 3. inositol 4. alanine…
A: Introduction: Phospholipids consititute the important group of compound lipids and are the most…
Q: full oxidation of 2 moles of glucose produce 36ATP O 72ATP 48ATP O 106ATP O
A: Anaerobic or aerobic respiration can occur within a cell.
Q: In competitive inhibition, increasing concentrations of the inhibitor will have the following effect…
A: When a molecule inhibits the enzyme activity that is called enzyme inhibition and the molecule is…
Q: Choose the correct option as the degree of unsaturation in a fatty acid increase Fluidity increases…
A: Fatty acids are classified into saturated and unsaturated based on the presence of double bonds.…
Step by step
Solved in 2 steps
- otein structure urs Chaperones AUG Zwitterion Tarm Aminoacyl-tRNA synthetase Unanswered 0 0/1 answered III I III A compound with no electrical charge made up of separate molecules with positive and negative charges that balance each other out. Attaches the appropriate amino acid to a tRNA molecule based on its anticodon. Surprisingly contains a thymine in it despite being a piece of RNA. Recognized by the anticodon UAC. Small group of proteins that assist protein folding. SubmitPosttranslational modifications of proteins do not include: peptide bond formation glycosylation acetylation of N-terminal peptide bond cleavage disulfide bond formation QUESTION 16 14 15 16 streptomycin puromycin 17 18 19 20 Which one of the following antibiotics does NOT function by interfering with the translational/post-translation process tunicamycin penicillin O tetracyclin O OMRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA Codons* (anticodon) tRNA Alanine GCU Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid AGA AAU GAU UGU GAA Glutamine CAA Glycine Histidine GGU CAU Isoleucine AUU Leucine CUU Lysine Methionine AAA AUG Phenylalanine Proline UUU CCU Serine UCU Threonine ACU Tryptophan Tyrosine Valine UGG UAU GUA * There are 64 codons. Some amino acids have several mRNA codons. There is, however, no overlap of codes. 1. You should be able to fill in the 3-letter "code-end" of the tRNA molecules in the table above. Remember, in RNA A pairs with U, and G pairs with C. There is no thymine. Fill in the table.
- 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ Transcribe the template strand be sure to use the 5’ and 3’ directions appropriately on the mRNA, feel free to rewrite the DNA strand if needed to make it easier to interpret. Make sure to label the mRNA with a "5'cap" and place 10 A's to form the poly-A tail.During translation, the tRNA antlicodon sequence G-A-U vyould blnd to which MRNA codon (plck one of the cholces I -V below)? Note: all of the sequencos for tho quostlon and answors use the standard convention for representing ollgonuclootidos discussed In class whoro tho 5'-ond Is at the loft and the 3'-ond Is at the right. I) G-A-U II) U-A-G I) C-U-A IV) A-U-C V A-T-C OA. none of the cholces OB. IV Oc." OD.! OE, IIFirst Letter A G U с 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the following DNA template strand, write out the amino acid chain produced. 23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "Genetic Code-Reference". Genetic Code-Reference UUU UUC UUA UUG CUU CUC CUA CUG (mutated or silent) (mutated or silent) b. Briefly explain your reasoning for each. (be sure to include both parts) AULLY AUU a. Label which of the following would result in a mutated amino acid sequence or a silent mutation. (May help to first determine the original amino acid sequence, then compare to mutations) U Phe mRNA codon sequence: anticodon sequence: amino acid sequence: Leu Leu 5'-AUA-GAA-3' Val 5'- AUC-GAC-3' AUC Ille AUA AUAJ *AUG Met/Start GUU GUC GUA GUG UCU UCC UCA UCG) CCU) CCC ccc CCA 000 CCG ACU ACU ACC ACA ACG, C GCU GCC GCA GCG Second Letter Ser Pro Thr 3'-CAA-GTC-TGT-5' Ala UAU UAC) Tyr Туг A **UAA Stop UAG Stop CAU] CACJ…
- Energy that drives translation is provided mainly by ___ . a. ATP b. amino acids c. CTP d. all of the aboveDuring translation elongation cycle, which of the following step(s) is/are repeated for each amino acid in polypeptide synthesis? Select all that apply. You may select multiple options. Opeptide bond formation O Ribosome scanning for initiation codon AUG O binding of second aminocyl-tRNA OtranslocationA segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
- Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…(ol soupe bannos96 SAM 3 A small strand of DNA has this sequence: 0pxbeter owl nade hoparg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Code-End of the Amino Acid MRNA Codons* (anticodon) tRNA Alanine GCU AGA Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid Glutamine Glycine Histidine AAU GAU UGU GAA CAA GGU CAU AUU CUU AAA AUG Isoleucine Leucine Lysine Methionine UUU Phenylalanine Proline CCU UCU Serine ACU UGG Threonine Tryptophan Tyrosine Valine UAU GUA There are 64 codons. Some amino acids have several mRNA codor There is, however, no overlap of codes.