The theory endosymbiosis is important in understanding how mitochondria and eukaryotic cells may have evolved.what structure is central to the concept of endosymbiosis
Q: Q5
A: The objective of the question is to identify the correct method(s) for controlling contaminants in a…
Q: A SNV mutation that results in no change in the amino acid sequence is called: A. silent mutation…
A: A mutation is a permanent alteration in the DNA sequence of an organism's genome. DNA, or…
Q: What is the relationship between the energy content of a photon and the wavelength of light? How…
A: Photosynthesis is a fundamental process in which plants, algae, and some bacteria convert light…
Q: Q6.5. What does the carrying capacity for moose on the island primarily depend on? The number of…
A: Explanation of carrying capacity:Carrying capacity refers to the maximum population size of a…
Q: Which of the following is an incorrect statement about the inheritance of the ability to taste the…
A: Phenylthiocarbamide (PTC) is a chemical compound regarded for its bitter flavor. The capacity to…
Q: Is tiktaalik more closely related to ray-finned or lobe-finned fish?
A: The question is asking about the evolutionary relationship between Tiktaalik, a prehistoric…
Q: What is Human Genome Project? What are its goals and benefits? What are the ethical, legal, and…
A: The genome is made up of genes and genes are made up of DNA. DNA is present inside the chromosomes…
Q: 5. Based on your understanding of allosteric regulation and using terminology related to the…
A: Glycogen phosphorylase is a key chemical involved in glycogenolysis, the breakdown of glycogen into…
Q: Rose plants are octoploid (octo = 8). Gametes from a rose plant contain 40 chromosomes. Indicate…
A: The correct statements are:The number of chromatids in a rose plant cell at G2 of the cell cycle is…
Q: Focal adhesions ________. a. have been implicated in cell locomotion b. contain integrins that…
A: The question is asking about the functions and characteristics of focal adhesions in cellular…
Q: Question 2
A: The objective of the question is to understand the results of an experiment involving mice and two…
Q: Briefly describe the steps in catabolism of glucose; showing the location where each step happens in…
A: Briefly describe the steps in catabolism of glucose; showing the location where each step happens in…
Q: How do attributes and properties defined in a frame align with the broader hierarchical taxonomic…
A: Frames are utilized to hold the attributes and properties of the concept or object in question and…
Q: If fatty acids are a more efficient storehouse of energy than glucose or glycogen, why aren't they…
A: The question is asking why fatty acids, despite being a more efficient source of energy, are not…
Q: In roses, purple flower color is determined by the dominant P allele, while pp homozygotes are…
A: We're dealing with a test cross in roses, where we're uncertain about the genotype of one plant. The…
Q: Caffeine inhibits feeding activity in tobacco hornworm larvae by inhibiting phosphodiesterase (PDE)…
A: The objective of the question is to understand how caffeine affects the feeding activity of tobacco…
Q: The factors contributing to the prevalence of Type 2 diabetes among Jamaicans
A: The objective of the question is to identify and explain the factors that contribute to the high…
Q: Please match the following hormones with their functions. Increases thyroid hormone secretion…
A: ADH- Decrease urinationGlucagon- Increases blood sugarOxytocin- Increases uterine…
Q: Discuss the impact parasites have on food webs and whether, or not, they should be included in such…
A: Parasites play an important role in food chains. They have the potential to significantly alter…
Q: is cow milk better than goat's
A: Title: Comparative Analysis of Cow Milk and Goat Milk: Which is Better?Introduction:In recent years,…
Q: Compare the food labels of almond milk unsweetened and almond milk sweetened with vanilla. Name two…
A: The objective of the question is to compare the food labels of unsweetened almond milk and vanilla…
Q: The Eustachian tube is important for equalizing air pressure within the middle ear. True…
A: The question is asking whether the Eustachian tube plays a role in equalizing air pressure within…
Q: Describe three characteristics of ambphibians. Think about reproductive needs, psyhical adaptations,…
A: The first characteristic of amphibians to consider is their reproductive needs. Unlike reptiles,…
Q: Subject: Environmental Physiology True or false: The process of an organism losing heat to the…
A: True. The process of an organism losing heat to the boundary layer decreases with wind speed. This…
Q: Part 6: Complete the chart below. Place an "X" in the appropriate column to indicate which mystery…
A: Fossils are the preserved remains of living beings that got buried under the layers of soil in such…
Q: Live Culture of Bacillus thuringiensis (Dipel) and B. subtilis (Kodiak) are sold as pesticides. For…
A: Answer is given below Explanation:
Q: Is the Degradation of Xrn1 in poliovirus-infected cells an example of virus-encoded molecules…
A: The objective of the question is to understand whether the degradation of Xrn1 in…
Q: But how are the two types of mesophyll involved? From what I understand, CO2 enters the stomata,…
A: In the process of photosynthesis, mesophyll cells play a crucial role in the conversion of carbon…
Q: Give correct typing answer with explanation
A: Symptoms- Cold: - Fever: Rare - Headache: Slight - General malaise: Common and abundant - Nasal…
Q: Caffeine inhibits feeding activity in tobacco hornworm larvae by ________. a. Inhibiting…
A: Cyclic adenosine monophosphate (cAMP) is produced from ATP (adenosine triphosphate) by the enzyme…
Q: Trophic Cascade Concept Map Primary Producers: Include at least two different types of primary…
A: Trophic Cascade Concept Map Primary Producers:Grass (Plant):Herbivores:RabbitGrasshopperAlgae…
Q: Q1: Draw the distribution of a continuous trait like dorsal fin length with a mean fin length of…
A: Definition: Polygenic inheritance is a type of inheritance pattern where a trait is influenced by…
Q: Mutation #3 DNA template: 3' TA CGCGCTGCACGATGCAGTAGTACATC 5' mRNA transcript sequence: Amino acid…
A: Mutation #3:DNA template: 3' TA CGCGCTGCACGATGCAGTAGTACATC5'mRNA transcript sequence: 5' AU…
Q: Please provide explanation for each step
A: The CD28/B7 and CTLA-4/B7 interactions are crucial in the immune response. CD28 is a co-stimulatory…
Q: Compare and contrast the social organization of orangutans, gorillas, and common chimpanzees.…
A: Orangutans, gorillas, and chimpanzees are all intelligent and sociable species, yet their social…
Q: How does a malaria infection cause fever?
A: Fever and associated symptoms are the hallmarks of malaria, a febrile sickness. It's crucial to keep…
Q: Why tablet compression is necessary? Please answer at your own easy words.
A: The objective of the question is to understand the importance of tablet compression in the…
Q: Chemical bond energy: Is the energy used by photosynthesis for the fixation of carbon Is generated…
A: The question is asking us to identify the correct statement(s) about chemical bond energy. Chemical…
Q: 3. At what age or time in life does an individual acquire the antibodies against ABO antigensother…
A: 3. Individuals typically acquire antibodies against ABO antigens other than their own during the…
Q: The majority of carbon dioxide is transported in the form of bicarbonate ions. True…
A: The question is asking whether the majority of carbon dioxide (CO2) in the body is transported in…
Q: Key: with glucose without glucose
A: The image shows a bar graph with the rate of CO_2 production on the y-axis, measured in parts per…
Q: what is the difference between biomass and waste biomass and how waste biomass is harmful to…
A: a)Biomass refers to organic materials derived from plants and animals, such as wood, crops,…
Q: Each hemoglobin molecule can combine with ____ molecule(s) of oxygen a. 4 b. 1 c. 3…
A: The question is asking about the number of oxygen molecules that can bind to a single hemoglobin…
Q: What is the role of the liver in bilirubin metabolism? O a. The liver converts bilirubin into…
A: Hormones are biochemical messengers that help your body coordinate its various processes. Several…
Q: 13. Summarize the Stages of the Photosynthesis Stage 1 Photo Stage 2 Synthesis Location: Location:…
A: 13. Stages of Photosynthesis:Stage 1:- Location: Occurs in the thylakoid membrane of chloroplasts.-…
Q: Which of the subsequent options is not included in the red list criteria for species classified as…
A: IUCN Red List was founded in 1964. In this list the threatened species are categorized into…
Q: Describe the function of the insulin molecule in the body.
A: Hormones are biochemical messengers that help your body coordinate its various processes. Several…
Q: What is the validity of concern for potential marine extinction? Defend these concerns or lack…
A: Concern for potential marine extinction is undeniably valid given the multitude of threats…
Q: Read the statements below and determine which f the recombination mechanisms that it matches with -…
A: StatementTransformationConjugation (F+xF-)Conjugation (Hfr x F-)Generalized…
Q: Subject: Environmental Physiology True or false: Urine dilution by the loop of Henle is dependent on…
A: FalseExplanation:The loop of Henle plays a crucial role in urine concentration and dilution in the…
Step by step
Solved in 3 steps
- The theory of endosymbiosis explains how or why ○ free living bacteria became Eukaryotic organelles ○ human guts evolved to have a microbiome ○ Eukaryotic cells acquired their nuclei ○ large food particles can be consumed by Eukaryotes, but not bacteriaa written explanation of the endosymbiotic theory as evidence for existence of eukaryotic organismsThe evolution of the eukaryotic organelles, mitochondria and chloroplasts involved endosymbiosis. Group of answer choices True False
- Some aspects of eukaryotes are more similar to archae while other aspects of eukaryotic cell composition appear closely related to bacteria. Explain how endosymbiosis could resolve this paradox.Endosymbiosis greatly altered eukaryotes as they acquired organelles. In the red algae shown below, the mitochondria is on left (solid lines), the chloroplast is in the middle (dotted lines), and the nucleus is on the right (dashed lines).The endosymbiont theory states that mitochondria andchloroplasts evolved from symbiotic relationshipsestablished between bacteria-like cells and theprecursors of eukaryotic cells that engulfed them on what basis
- Which of the following pieces of evidence could support the endosymbiotic theory if found to be true? Traces of peptidoglycan in the cytoplasm in eukaryotes Presence of rRNA in eukaryotes Presence of 80S ribosomes in eukaryotes The discovery of a unicellular eukaryoteWhich of the following correctly describes the theory of endosymbiosis. Question 9 options: Mitochondria evolved from a genetic mutation within an ancestral prokaryote. An ancestral prokaryote engulfed another prokaryote that eventually evolved into the organelles we recognize as mitochondria and chloroplasts. Some species of prokaryotes can pick up plasmids left behind by other prokaryotes.which statement can be used as evidence for the endosymbiosis theory
- The answer to the question of how eukaryotic cells evolved has been suggested in the Endosymbiotic Theory. Provide at least 4 pieces of evidence to support this theory.Which of the following is not true concerning the mitochondria and chloroplasts and is not evidence in support of the Endosymbiotic Theory? Both divide independently of the eukaryotic cell they are within Both contain their own DNA in a single, circular chromosome Both can survive independently when removed from a eukaryotic cell Both are about the same size as a bacteriaMitochondria and chloroplasts contain some DNA, which more closely resembles prokaryotic DNA than (eukaryotic) nuclear DNA. Use this information to suggest how eukaryotes may have originated.