How many glucose and amino acid molecules need to be used in order to obtain the same amount of energy that is produced from 14 carbon fatty acid? Please show your work. Write your final answers in the box provided. Glucose Amino acid
Q: The bacterial operon (a set of co-expressed genes) shown below contains one promoter (green), two…
A: In a bacterial operon a single mRNA containing multiple genes are transcribed from a single…
Q: What are the essential amino acids and how does the body get them? Give an example of one of them…
A: DISCLAIMER FOR MULTIPART Since you have posted a question with multiple sub-parts, we will solve…
Q: The figure below illustrates what reactions of amino acids? coo &C=0 CH₂ CH₂ 0=( 00 + NHⓇ NAD(P)H+H…
A: The amino group, carboxyl groups, and side chains of amino acids all play a role in how amino acids…
Q: What biomolecules have alcohol functional group in them? Give an example of a specific biomolecule…
A: Biomolecules possess different functional groups such as alcohol group, amino group, carboxyl group,…
Q: Which statements best describe serotonin? Select the correct response(s): It is essential for…
A: Serotonin is a neuro transmitter that transmit the messages from one neuron to other neuron. It is…
Q: 3. DNA: TACGGGCCTATACGCTACTAC TCATGGATCGG mRNA: Codon: Anitcodon: Amino Acids:
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: Indicate whether the following pairs of monosaccharides are aldoses or ketoses. a. D-altrose &…
A: INTRODUCTION : Monosaccharides : They are also known as simple sugar. They are the simplest forms of…
Q: During anaerobic conditions, lactate travels from the muscle to the liver via the bloodstream. What…
A: The Tricarboxylic acid(TCA) cycle is inactive under anaerobic conditions, thereby the process of…
Q: Cyt cb562 will form a tetramer in the presence of Zn+2 or in the absence of Zn+2, it will form a…
A: INTRODUCTION : Cyt cb562 - Cytochrome cb562 is a variant of an Escherichia coli four-helix bundle…
Q: Question 15 of 25 Which of the following is true for the acid-base properties of amino acids? Select…
A: The proteins are made of 20 naturally occurring amino acids. The net charge on the side chain of the…
Q: Use the table below to answer the question being asked: Protein Ovalbumin Insulin Fibrinogen…
A: Two dimensional (2D) polyacrylamide gel electrophoresis (2D PAGE) is a more powerful technique than…
Q: What is the property/characteristics of DNA that makes it insoluble to ethanol/isopropyl alcohol?
A: The mechanical separation of the nuclear contents from the remainder of the cell, accomplished by…
Q: Why is Hopkin's Cole test specific for tryptophan?
A: There are are biochemical tests that can be used for the detection of proteins and amino acids in a…
Q: 1. Inulin is a polysaccharide composed of entirely fructose units. Which test should be used to best…
A: Introduction : Inulin - Inulin is a type of naturally occuring polysaccharide which is produced by…
Q: Many proteins that remain homogeneously distributed in water have molecular masses in the range of…
A: A colloid is a heterogeneous mixture in which the dispersed particles are intermediate in size…
Q: Based on the structure of sucrose below, is it classified as a reducing sugar? 6CH OH ОН ОН 3…
A: Chemically, carbohydrates are polyhydroxy aldehydes/ketones. They have the general formula :…
Q: Give the isoelectric points of following 2 tripeptides DRI and RID.
A: pI (isoelectric point) of an amino acid is the PH at which the amino acid carries zero net charge. A…
Q: Describe two different ways in which glucose oxidase is regulated. These mechanisms of regulation do…
A: Glucose oxidase: It is an oxidoreductase that catalyzes the conversion of glucose to hydrogen…
Q: Why only distilled water used as a solvent for the DNA molecules? What is the characteristic of the…
A: DNA stands for deoxyribonucleic acid, it is a genetic material found in all cells. It is basically a…
Q: Given the following standards and the corresponding standard curve table, what is the amount of…
A: The enzymes are protein molecules that increase the rate of reactions by decreasing the activation…
Q: Chemistry help
A: pI (isoelectric point) is the PH at which a molecule carries no net charge. Isoelectric focusing is…
Q: State what each of the following symbols stands for, be specific. 4. M 5. SD 6. α
A: Introduction There are various symbols are used in science. Scientific writing requires various…
Q: INFLUENCE OF FREE ACID tt #1 tt #2 tt #3 tt #4 CONDITION 4 mL 0.2% HCI + 1 mL starch paste + 1 drop…
A: Effect of saliva on starch: Saliva contains the digesting enzyme amylase, which breaks down starch.…
Q: Events that occur in the peroxisomes incluce the following EXCEPT oxidation of fatty acids…
A: Peroxisomes are small, membrane-bound organelles in eukaryotic cells that contain enzymes involved…
Q: What are the roles of the other enzymes involved in replication and why they're necessary ?
A: Before cells divide, DNA replication must occur. DNA replication is the complete, faithful copying…
Q: Describe the biological functions of lipids. What factorscan affect the transition temperature (Tm)…
A: Lipid is a biomolecule which is soluble only in nonpolar solvents. They are hydrocarbons which…
Q: 16. If the aerobic catabolism of 1 mol of glucose yields 38 mol of ATP, and the energy released by…
A: "Since you have asked multiple questions, we will solve the first question for you. If you want a…
Q: Which is an appropriate statement of involvement of the hydrophobic effect in protein folding? A)…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Beer's Law to determine Protein Concentration You have purified a recombinant form of the p53…
A: The determination of protein concentration is necessary for diverse biochemical experiments. The…
Q: The proton-motive force is a measure of the potential energy generated across the mitochondrial…
A: The catabolism of carbohydrates, fatty acids, and amino acids generates the reducing equivalents…
Q: Which of the following is associated with the process of ATP re-synthesis during exercise? a.…
A: During exercise, the muscles are reliant upon the ATP molecules. ATPs provide the energy essential…
Q: Since higher concentration colcemid will result in shorter chromosome, you want to change your…
A: It is given that: Molar concentration of the stock solution: 10 ug/ml. Desired dilution…
Q: What is most correct about the following inhibition? Penicillin
A: The antibiotic penicillin irreversibly binds to and inhibits the activity of the transpeptidase…
Q: Which form of fructose ,alpha or beta does take part in most biochemical reactions
A: Two-dimensional representation of cyclic structure of monosaccharides are called Haworth projection.…
Q: 11. Use the data below to answer the following question: How much more energy is stored in a gram of…
A: Glycogen and fat are two molecules used by human body to store energy. The inside and even outside…
Q: 1) Which of the following statement(s) regarding the ends of polysaccharides are true? All…
A: The biological macromolecules can be classified as proteins, nucleic acids, lipids and…
Q: Which of the following statements is CORRECT? A) Hexokinase IV is allosterically inhibited by…
A: Enzyme plays an important role in all the metabolic activities in our body. They themselves remain…
Q: F.28. How will phosphorylation of serine change the pKa of Arg, increase, decrease, or no change
A: Serine is a polar but uncharged residue. Arginine is a basic residue due to the presence of an amine…
Q: Name three metabolic processes in the cell that are enhanced and two that are inhibited in response…
A: Insulin is a peptide hormone that regulates blood glucose in levels in the body. It decreases the…
Q: The second high energy intermediate metabolite of glycolysis that can be used for substrate level…
A: Nonessential amino acids can be synthesized in the body in which the cells provide the carbon…
Q: 5-45 A sample of an unknown peptide was divided into two aliquots, acid. One aliquot was treated…
A: Edman degradation method is used for the sequencing of polypeptide chains. For larger proteins the…
Q: ESPIRATION - What is the purpose of cellular respiration? Where is cellular respiration performed…
A: Cellular respiration is the process of oxidizing nutrients like glucose to carbon dioxide and water.…
Q: Studies of a specific enzyme activity showed that the time the enzyme activity before complete…
A: An organic substance called an enzyme acts as a catalyst for a biological reaction. Each cell in the…
Q: How can chirality and stereoisomers influence the pharmacology, bioactivity, toxicology,…
A: Ibuprofen is a Non-Steroidal Anti-Inflammatory Drug (NSAID). Ibuprofen does this function by…
Q: Although initiation requires the sigma factor or sigma subunit be associated with the core RNA…
A: Transcription is a process by which RNA is synthesized using DNA as template. Transcription occurs…
Q: Explain the cell response to FED, and then FASTED states, by glucose transporter (GLUT)-4. (answer…
A: Carbohydrate from food is converted to glucose by digestive enzymes which then enters the…
Q: what does this picture indicate? what is difference bewteen A, B, and C ?
A: INTRODUCTION : Myoglobin - It is an iron and oxygen binding protein found in the skeletal &…
Q: Refer to the chromatograph (Figure 1) below and answer the questions that follow: What is the…
A: Affinity chromatography is a separation technique that takes advantage of the ligand specificity…
Q: In an Absorptive (fed) state Which predominates? Anabolic or catabolic processes? Which ones…
A: Metabolic pathways are a series of process which includes chemical reactions occurring in a cell.…
Q: . The book dived into allosteric enzymes and how they are regulated in metabolic pathways, but…
A: Michaelis Menten enzymes are those that follow MM kinetics. These enzymes have their reaction rates…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images
- Which carbons of glucose will be incorporated into Palmitic acid by the Fatty Acid Synthase? Multiple answers:Multiple answers are accepted for this question Select one or more answers and submit. For keyboard navigation...SHOW MORE a Carbon 1 b Carbon 2 c Carbon 3 d Carbon 4 e Carbon 5 f Carbon 6 g All carbons will be incorporated. h No carbons will be incorporated.fill in the blank with the correct term and explain why that term fits best to the following , one reason to phosphorylate glucose is to increase the number of available noncovalent interactions between the phosphorylated sugar and the enzymes, thus increasing the ____________.Please describe the steps by which the carbons in ketogenic amino acids could be incorporated into fatty acids? Enter your answer here
- This first question asks you to group the different answers into the correct category. Our two categories are Anabolic and Catabolic. Decide how to categorize each word or phrase. This is all-or-none; no partial credit. Catabolic Anabolic No Answers Chosen No Answers Chosen Neither No Answers Chosen Possible answers glycolysis ⠀⠀ lactic acid is transported to the liver, where it is converted to glucose acyl-CoA transfers 2Hs to FAD to form a double bond in the acyl-chain and FADH2 Glucose-6-Phosphate is isomerize to Fructose-6-Phosphate beta-oxidation glucose--> glucose-6-phosphate GTP + ADP ==> GDP + ATP SubmitFor each of the four possibilities listed below (a through d), only one answer is correct and the others are false. Identify the correct statement and explain why the others are false. In your answer, write CORRECT next to the statement that you think is true, and ONLY for the ones that you think are false, explain what is wrong with the statement . When glucose reacts with ATP to form glucose-6-phosphate (as shown on the figure below): 1. The synthesis of glucose-6-phosphate is exergonic 2. ADP is at a higher energy level than ATP 3. Glucose-6-phosphate is at a higher energy level than glucose 4. Because ATP donates a phosphate to glucose, this is not a coupled reactionChoose the best answers for each missing word from the list below. ____ regulated by ATP, Aspartate transcarbamoylase (ATCase) is (1) which is a (2)________________ regulator, and by CTP which binds to the (3)____ subunit of ATCase and shifts the conformational equilibrium to the (4). T state. CTP regulation of ATCase is called (5)________ 1) allosterically, 2) positive, 3) regulatory, 4) inactive, 5) feedback inhibition 1) covalently 2) positive, 3) regulatory, 4) active, 5) feedback inhibition 1) allosterically, 2) negative, 3) regulatory, 4) inactive, 5) feedforward activation 1) allosterically, 2) negative, 3) catalytic, 4) active, 5) feedforward inhibition 1) irreversibly, 2) positive, 3) catalytic, 4) inactive, 5) feedback inhihition
- Write down the chemical reactions with intermediates, enzymes, and coenzymes that are involved in the conversion of glucose to glycogen (no need to list the substances, suffice it to name them).Below is a table of the nutritional information for Jim's takeaway meal. Use this data to complete the table by calculating the energy in kilojoules for the foods in the meal. PLEASE DON'T USE ANY COMMAS IN YOUR ANSWERS. Important tip: the total fat includes saturated fat and carbohydrates include sugars so for the energy from fat you only need to calculate the energy from total fat and NOT from total fat + saturated fat. Table: Nutritional information for Jim's takeaway meal Chicken Hot fudge BBQ dipping Coke "Big Cheese" Burger (nutrients per Cheese Fries McNuggets (per 100g) (per x10 nuggets) sundae (per large serving sauce (per large serving) burger) (per 100g) 500mls) Energy (kJ) Protein (g) 65.2 4.8 23.3 1.0 0.0 9.0 Fat, total (g) 68.5 16.0 24.9 1.0 0.0 14.3 Saturated fat 33.4 1.3 3.9 1.0 0.0 10.1 (g) Carbohydrate 45.1 33.8 22.4 34.6 53.0 93.1 (g) Sugars (g) 15.4 0.5 0.6 30.9 53.0 72.6 Sodium (mg) 1540 292 735 564 50 214Before amino acids can be used to manufacture glucose, ATP, or fatty acids they must be ____________.
- All the Bold answers are wrong please explain why it is wrong and give me the correct answer. Thanks, in advanced Which of the following is true about enzymes? Enzymes are equally effective across broad ranges of temperature and Ph. Enzymes lower the overall free energy of a reaction to make it spontaneous. Enzyme activity is generally unregulated. Enzymes recognize many substrates with equal specificity. The insulin receptor catalyzes the phosphorylation of several substrates and is therefore classified as a Transferase Phosphate Kinase Lyase Oxidoreductase 3)Which of the following reaction parameters can enzymes optimize to increase reaction rate? The proximity(=closeness) of the reacting groups. The rotational motions of the substrates and catalytic groups. The orientations of the substrates and catalytic groups. The achieve energy needed to achieve the transition state. The catalytic mechanism of RNA relies upon general acid-base catalysis involving the amino acid…The relationship of glucose-6-P and fructose-6-P is that they are ____________________. The same relationship is seen between the molecules _____________________ and ____________________.Please explain the requirement for ATP in the overall process of fatty acid biosynthesis. Enter your answer here