3. DNA: TACGGGCCTATACGCTACTAC TCATGGATCGG mRNA: Codon: Anitcodon: Amino Acids:
Q: The figure below shows a polynucleotide: a) Label the 5' and the 3'…
A: Polynucleotide are polymer of nucleotides which are formed by the condensation of nucleotide. The…
Q: Select the chemical consequences that could contribute to DNA instability at AP sites. fewer…
A: AP sites are apuraniya sites that are created through the hydrolysis of N glycosyl bond between…
Q: 1. Why do proteins become polycations at extremely low pH and become polyanions at very high pH? 2.…
A: Proteins are biological macromolecules formed by monomers of amino acids. The amino acids have side…
Q: Why doesn't the enzyme bromelain digest the proteins in your stomach when you eat fresh pineapple?
A: Enzymes are high molecular weight protein molecules that catalyse biochemical reactions. The…
Q: In an Absorptive (fed) state Which predominates? Anabolic or catabolic processes? Which ones…
A: Metabolic pathways are a series of process which includes chemical reactions occurring in a cell.…
Q: Which of the following statements is CORRECT? A) Hexokinase IV is allosterically inhibited by…
A: Enzyme plays an important role in all the metabolic activities in our body. They themselves remain…
Q: 11. Use the data below to answer the following question: How much more energy is stored in a gram of…
A: Glycogen and fat are two molecules used by human body to store energy. The inside and even outside…
Q: CH₂OH c=0 НО-С-н H-C-OH H-C-он H-C-он CH2OH
A: Monosaccharides are also called simple sugars and are are polyhydroxy aldehydes or ketones. The D…
Q: If a dialysis tube that is permeable to water but not sucrose contains a 40% sucrose solution that…
A: Water travels across a semi-permeable membrane from the side of the membrane with a lower…
Q: What are the components of a nucleotide? Provide 1- or 2-sentence description of each component.
A: Nucleic acids are biomolecules that are essential for all life forms. They are polymers of…
Q: Select ALL of the following that are made during the Kreb's Cycle. ATP CO₂ NADH FADH2
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by oxidation of…
Q: Which of the following exist at a pH < pl for the amino acid alanine? NH3 no correct response NH3 OH…
A: Alanine is a non-polar (hydrophobic) amino acid. The pH of the solution determines the state in…
Q: Will weighs 80 kg and his plasma osmolarity is 280 mOsm/L. He eats a salty snack containing 250 mM…
A: Plasma Osmolarity: The number of solute particles per 1 L of solvent is referred to as osmolarity.…
Q: What charged groups are present in leucine at a pH = 7? OA) 1× NH3¹ B) 1 x COO OC) 1× NH3¹ and 1 ×…
A: Amino acids have a central carbon atom known as α-carbon atom. Each amino acid has an amino group,…
Q: What is the purpose of using a strong acid in the Seliwanoff’s test
A: Carbohydrates are polyhydroxy aldehydes or ketones or biomolecules that yield polyhydroxy aldehydes…
Q: How many of the following statements are true? Allosteric enzymes display sigmoidal kinetics for…
A: Allosteric enzymes are enzymes that possess additional binding sites known as allosteric sites.…
Q: 3. Supra-secondary structures of proteins - supercoiled alpha- helix, Greek key, meander, interlock,…
A: Protein: The amino acids are arranged in a long chain and joined to one another by covalent peptide…
Q: Conversion of disaccharides to monosaccharides are associated with: O stomach O intestinal mucosa…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: Consider the pyruvate carboxylase reaction, the first bypass step in gluconeogenesis: Pyruvate + CO₂…
A: Gluconeogenesis is a process by which cells make glucose from non carbohydrate sources.…
Q: Chemistry help
A: pI (isoelectric point) is the PH at which a molecule carries no net charge. Isoelectric focusing is…
Q: For the structure shown on the figure - qualitatively draw Ramachandran plot. Assume a mixture of…
A: Ramachandran plot is plot used to visualize energetically allowed regions for the peptide backbone…
Q: A reaction has a Gibbs free energy change (AG) of +5.3 kcal/mol. Indicate whether each of the…
A: Introduction The Gibbs free energy of a system means the amount of usable energy. The change in…
Q: 4) a) Draw the peptide ASYTL at pH 7 and 12. b) Draw a Titration Curve for this peptide. c) If this…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: Identify the components of animal fatty acid synthase (FAS). acyl-CoA dehydrogenase B-ketoacyl…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: The active site _______________. a. is the compound that an enzyme reacts with during the chemical…
A: The active site is that region of an enzyme where substrate molecules bind. The binding of substrate…
Q: At a pH of 10, would you expect this peptide to be retained for a longer time within an anion…
A: Ion exchange chromatography separates molecules based on their charge difference. A cation exchange…
Q: ĭ HO O-C-R' O=O=O=O -O-C-R" -O-C-R"" A -P=00=0 HII -N-C-R" OH E O-sugar O || -0-C-R" -NH3+ -(CH₂)12…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: If we were handed a tube of 2mg/mL BSA how much is required 20μL of each of the following…
A: Different concentrations of protein solutions are needed to be prepared during biochemical…
Q: -Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the…
A: Note: Hi! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: AMP is an activator of fructose 1,6-bisphosphatase (FBPase-1) True False
A: Glycolysis is the process by which one molecule of 6 carbon glucose is broken down into 2 molecules…
Q: 1. What two enzymes in glycolysis are regulated by high ATP concentrations?
A: INTRODUCTION : Glycolysis : It is a metabolic pathway in which glucose is breaken down into pyruvate…
Q: impact on the number of electron carriers used by the electron transport chain? Select one: The…
A: Introduction Cellular respiration is of two types: aerobic respiration and anaerobic respiration.…
Q: 4. RNAse A cleaves the phosphodiester backbone of RNA. Draw its mechanism.
A: INTRODUCTION : RNA - It is called Ribonucleic acid, It is a nucleic acid which is present in all…
Q: Using an arrow, draw the site of cleavage for the following peptides that are reacted by: Pepsin…
A: Site specific proteases are enzymes that cleaves polypeptide chains only at specific points. Trypsin…
Q: (pmol) (a-32P) GMP INCORPORATED N 111 (a) (b) (c) 20 5 (min) 2.6 10 The image above shows an…
A: In eukaryotes the RNA Polymerase II is involved in the synthesis of mRNA. The RNA polymerase and…
Q: Discuss the role of carbohydrates on cancer and suggest an appropriate treatment
A: Carbohydrates are biomolecules, which are the primary source of energy for the body. All of the…
Q: 10. CH OH HO -0-3 OH C I II. Cд H_Os 12. С 8 Hile O_ 13. СА Н 14. C Hio Os 15. C_H_D- 16. C_H 1 20 -…
A: Carbohydrates are polyhydroxy organic compounds with a general formula of (CH2O)x. Carbohydrates can…
Q: Even in automated sequencing, where you can include all 4 ddNTPs in one reaction, you need to…
A: Introduction DNA acts as a genetic material in our body. DNA is a double stranded molecule. It is a…
Q: 1. Under what circumstances in the cell would the entire pentose phosphate pathway be carried out…
A: The pentose phosphate pathway is also called HMP shunt pathway. It branches from glucose 6-phosphate…
Q: The activity of an enzyme can be regulated by a: A) competitive inhibitor binding to the active…
A: The enzymes increase the rate of biochemical reactions and can be regulated by binding to…
Q: Which of the following correctly matches the chromatography technique with the molecular property…
A: Chromatography is a laboratory technique for the separation of a the components that are present in…
Q: Biochemical events in the synthesis of ATP: I. Subunits of ATP synthase chages in conformation and…
A: ATP synthase is a complex enzyme consists of an F0 and F1 components. It uses the proton motive…
Q: Which sequencing project(s) would be done better using a next generation method (like Illumina)…
A: Sanger sequencing method - it is also known as chain termination method of gene sequencing. This…
Q: 6-25 For Umax 57(Kr+S) constant an enzyme that displays Michaelis-Menten kinetics, what is the…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: Now use the equations above and the empirical values below to calculate VO₂ (the rate of oxygen…
A:
Q: A peptide has the following amino acid composition: 2 Met, 2 Phe, 2 Glu, 1 Arg, 1 Lys, 1 Val, 1 Leu,…
A: Recall that: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal…
Q: Which of the following substances can deliver electrons to the ETC to help pump out H+ across the…
A: Electron transport chain is a chain of electron carriers that transfer electrons to molecular…
Q: Which of the following enzymes requires Mg2+ to carry out its function? Alcohol dehydrogenase.…
A: An enzyme draws substrates to its active site, catalyzes the chemical reaction that creates the…
Q: L 3
A: Since you have asked multiple questions, we will ask only first question for you. In order to get…
Q: Question 7 In the human body, under oxygen rich and oxygen poor conditions, respectively, pyruvate…
A: Respiration at molecular level refers to the process through which cells catabolize biomolecules…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 2 images
- Directions: Transcribe the DNA sequence in the space provided. Use your notes and what you know. Remember, what pairs with A? With C? DNA sequence: ACСА СТА ССТ СТС АТT MRNA sequence: UGU GAU Directions: Now use the codon chart to translate the mRNA sequence into an amino acid chain. Second letter A G UUUPhe UAU Tyr UCU UCC UCA UCG UGU UGCCYS UAA Stop UGA Stop A UUC UAC Ser UUA UUG Leu UAG Stop UGG Trp G CAU CGU] CUU CUC CUA CUG CCU CCC CCA CCG His CAC CAA Gin CGC Leu Pro CGA Arg A CAG CGG AAU Asn ACU ACC ACA AUG Met ACG AGU ser AGC AGA Arg AUU AUC Fle AAC Thr AUA AAA AAGLYS AGG. G GGU GGC GCU) GAU GUU GUC GUA GUG GAC Asp GAA GCC Ala GCA Gly Val GGA A GCG Glu GGG GAG, Amino acid sequence:Cys + Asp First letter Third letterCodon chart: We interpret mRNA 3 base pairs at a time. This is known as a codon. A codon table can be used to translate a genetic code into an amino acid sequence. The full set of relationships between codons and amino acids (or stop signals) is called the genetic code. The genetic code is often summarized in a table like the one below. Second letter A G UUU UUC J UGU Cys UCU) UCC UCA UCGJ UAU U Phe Tyr UACS UGCJ Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUA UUG FLeu G CUU ) CỤC CUA CUG CCU ) ССС ССА CCG CGU CGC Arg CAU) CÁC His САА Leu Pro CGA Gin CAG CGG AUU AAU ACU АСC ACA Asn AGU Ser AAC JAsh AGC. AUC le A AUA AGA Arg Thr AAA AAG. }Lys A AUG Met ACG AGG J G GUU GUC G Val GUA GUG GCU) GCC GCA GCG GAU1 GACS GAA) GAG Glu GGU GGC Gly U C A Ala GGA GGG] G First letter UUAG Third letterTranslate the following RNA sequence by using the genetic below. Start at the beginning of the sequence and don't worry about start and stop codons. Write out the sequence using the single letter code. (This table displays the amino acids in a single-letter code instead of a three-letter code. Each codon is found by matching the first position on the left of the chart, second position at the top, and last position at the right. For example, the codon CAG gives the amino acid "Q") 5' UCAACUGCGAAUCUGGAAUAU 3'
- State if the DNA is written 5' to 3' or 3' to 5' Transcribe the sequence. Include the 5' and 3' Translate the sequence (codon chart included) +1 TAGTCCAAAGGTTTACGTAAATGGGATGTCGAAATTGACTAGATCADescribe the process of translating mRNA into proteins. Be sure to also include the following key terms: tRNA, ribosomes, codon, base pairs, cytoplasm, amino acids.In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then, for each set of three DNA and complementary mRNA nucleotides, use the amino acid chart to translate the nucleotides into amino acids, and type them below. DNA T-A-C A-A-G A-T-G G-G-G A-T-T mRNA Enter Text — Enter Text — Enter Text Enter Text — Enter Text — Enter Text Enter Text — Enter Text — Enter Text Enter Text — Enter Text — Enter Text Enter Text — Enter Text — Enter Text Amino acid Enter Text Enter Text Enter Text Enter Text Enter Text
- Using the codon charts in your text (section 6.1), fill in the chart below. [ /8] Original DNA sequence TAC GGA CAC GTT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Mutated DNA sequence TAC GGA CAC ATT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Type of mutation (highlight all that apply) Frameshift Nonsense Missense Silent Insertion Deletion SubstitutionUsing the genetic code, translate your mRNA sequence of 60 nucleotides into a polypeptide. Use one-letter abbreviations for the amino acids. Enter one-letter abbreviations corresponding to the amino acids.Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3
- Use a codon chart determine the amino acid sequence. Remember to read through the strand and ONLY start after the promoter and STOP when it tells you to stop. Follow example below: Example: DNA AGA TATA TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC MRNA O protein AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG start-glu-ala-thre-hist - asp-glu-threo-stop met DNA CCT ATA TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC mRNA DGGA UAU) AUG uGul Gcc nccl cAul GCol protein ly Tur MeT cys AlA ser HIJ Ala 2 3 4 DNA AGA ACT ATA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA mRNA protein DNA TAT ATAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC mRNA protein D DNA TAA ACT ATA TAC CTA GCT TAG ATC TAA TTA CCC ATC mRNA protein Auu UGA UAU AGU GAUCGA AUC MAG Auu AAU leu Stop. TRY-Met-Asp- ARG-Isle-Stop-Ile. Asn DNA CTA TTT ATA TAC TAG AGC GAA TAG AAA CTT ATC ATC mRNA protein D DNA CAT ATA TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG…INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: Amino acyl tRNA synthase is the enzyme responsible for joining amino acid together STAMENT 2: Nucleus is the part of the cell where translation takes place ANSWER: STAMENT 1: DNA sequences where RNA polymerase binds initially is called promoter sequences STAMENT 2: UV light causes adenine to dimerize ANSWER: STAMENT 1: Guanosine is the name of the compound formed when guanine is bonded to ribose STAMENT 2: DNA pairing is the term that refers to the process when two complementary and single stranded DNA combine ANSWER:Fill in the complementary DNA strands for the DNA strands below Which nitrogen base CAN'T you use during replication? ATTCGATGC TACGGATCG CAGTGACTT PROTEIN SYNTHESIS TRANSCRIPTION Use the DNA strands provided to create the m-RNA strands Which nitrogen base CAN'T you use during transcription? ACTGGATAC ACGGATCGT TGACAGCT A TRANSLATION: USE the DECODING WHEEL to DETERMINE the AMINO ACID that Which amino acids have ONLY ONE corresponds to the m-RNA CODE GIVEN: codon? MRNA CODE AMINO ACID AAA GCG Tyrosine Stop GAU Alanine GU A C CAA GU Cysteine Stop Loyptophan U CAC Valne UUU Arginine AC A Leucine Serine Which two mRNA codes correspond to histidine? lysine A Proine Asparagine CACUCA How many different MRNA codes correspond to Threonine? Tell the amino acid sequence for the following MRNA message: MRNA MESSAGE: AUG CCA UGG CAU Phenyl- alanine Leucine Serine aid Aspartik Glutamk Glydne acid Methionine soleucine Histidine Glutamine Arginine Threonine